RIKEN DNA Bank Human Resource

RIKEN DNA Bank Human Resource - MFGE8

Gene ID	NCBI Gene 4240 \| KEGG hsa:4240
Gene Symbol	MFGE8
Protein Name	milk fat globule EGF and factor V/VIII domain containing
Synonyms	BA46\|EDIL1\|HMFG\|HsT19888\|MFG-E8\|MFGM\|OAcGD3S\|SED1\|SPAG10\|hP47

Ortholog resource in our bank

  MFGE8

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Individualy Deposited Resource

Catalog number	Name of Resource	Description
RDB18995	pEF-human MFG-E8/Flag	Mammalian expression vector of human MFGE8 (MFG-E8) tagged with FLAG at C-terminus.

webcatalog20220516.tab

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number	Clone name	Vector	Sequence submitted (DDBJ)⁽¹⁾	CDS comparison
Catalog number	Clone name	Vector	Sequence submitted (DDBJ)⁽¹⁾	Refered (NCBI mRNA)	CDS status⁽²⁾
HGY081298	IRAL003E02	pOTB7	BC003610	NM_005928	Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Jun29.csv
GNP_full_IRAL_2023Jun29.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number	Clone name	Vector	CDS comparison
	Clone name	Vector	Refered mRNA⁽¹⁾	CDS status
	5'-terminal sequence⁽²⁾
HKR079281	ARe98D09	pKA1U5	NM_005928.2
HKR079281	GGATTTATTCCGGTCCCAGAGGAGAAGGCGCCAGAACCCCGCGGGGTCTGAGCAGCCCAG
HKR164059	ARi10C11	pGCAP10	NM_005928.2
HKR164059	GATTCCGGTCCCAGAGGAGAAGGCGCCAGAACCCCGCGGGGTCTGAGCAGCCCAGCGTGC
HKR203211	ARiS008A11	pGCAP10	NM_005928.2
HKR203211	TAGAACCCCGCGGGNNCTGAGCAGCCCAGCGTGCCCATTCCAGCGCCCGCGTCCCCGCAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.10.05

Homo_sapiens_gene_info230514.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl