DNA Bank Top |  KEGG KO K17253 > 

RIKEN DNA Bank Human Resource - MFGE8

Gene ID NCBI Gene 4240 |  KEGG hsa:4240
Gene Symbol MFGE8
Protein Name milk fat globule EGF and factor V/VIII domain containing
Synonyms BA46|EDIL1|HMFG|HsT19888|MFG-E8|MFGM|OAcGD3S|SED1|SPAG10|hP47

Link

Ortholog resource in our bank

  MFGE8

External database

human MFGE8

Individualy Deposited Resource

Catalog number Name of Resource Description CDS comparison
Refered (NCBI mRNA) CDS status(1)
RDB18995 pEF-human MFG-E8/Flag Mammalian expression vector of human MFGE8 (MFG-E8) tagged with FLAG at C-terminus.    

(1) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.

webcatalog20240727.tab

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY081298 IRAL003E02 pOTB7 BC003610 NM_005928 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2024May11.csv
GNP_full_IRAL_2024May11.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR079281 ARe98D09 pKA1U5 NM_005928.2  
GGATTTATTCCGGTCCCAGAGGAGAAGGCGCCAGAACCCCGCGGGGTCTGAGCAGCCCAG
HKR164059 ARi10C11 pGCAP10 NM_005928.2  
GATTCCGGTCCCAGAGGAGAAGGCGCCAGAACCCCGCGGGGTCTGAGCAGCCCAGCGTGC
HKR203211 ARiS008A11 pGCAP10 NM_005928.2  
TAGAACCCCGCGGGNNCTGAGCAGCCCAGCGTGCCCATTCCAGCGCCCGCGTCCCCGCAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2024May11.csv
NRCDhumcloneList_RB_2024May11.csv

2024.10.03

Homo_sapiens_gene_info230514.csv - RDB_hum_GIxxxxxxxxx_html_240727.pl