Prev. | 

RIKEN DNA Bank Human Resource - MFAP4

Gene ID NCBI Gene 4239 |  KEGG hsa:4239
Gene Symbol MFAP4
Protein Name microfibril associated protein 4
Synonyms -
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB18691 pCI-neo MFAP4-MH wt Expression vector of human MFAP4, wild-type.
RDB18692 pCI-neo MFAP4-HA WF Expression vector of human MFAP4, mutant W235F.

webcatalog20220516.tab


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX025746 IRAK064G02 pCMV-SPORT6 BC035560 NM_002404 Partial
HGX056511 IRAK141E15 pCMV-SPORT6 BC062415 NM_002404 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2022Apr03.csv
GNP_full_IRAL_2022Apr03.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR321704 RBb04E08 pKA1U5 NM_002404.1  
GCGCAGACACCCAGCCACTCTGAGCAGAACTGACAGCATGAAGGCACTCCTGGCCCTGCC
HKR322033 RBb05B09 pKA1U5 NM_002404.1  
TGGAGGACTCTGAGCAGAACTGACAGCATGAAGGCACTCCTGGCCCTGCCGCTGCTGCTG
HKR341774 RBb54H06 pGCAP1 NM_002404.1  
GGCGGTTGCAGTCTGGGGCCGCAGACACCCAGCCACTCTGAGCAGAACTGACAGCATGAA
HKR462670 RBdS156L06 pGCAP10 NM_002404.1  
GGGCGGGGGCCCAGCGCATAACTCTGGGCGGTTGCAGTCTGGGGCCGCAGACACCCAGCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2022Apr03.csv
NRCDhumcloneList_RB_2022Apr03.csv


2022.05.16

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_220215.pl