Prev. |  KEGG KO K13110 > 

RIKEN DNA Bank Human Resource - MFAP1

Gene ID NCBI Gene 4236 |  KEGG hsa:4236
Gene Symbol MFAP1
Protein Name microfibril associated protein 1
Synonyms AMP
Ortholog resource in our bank

  MFAP1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX044340 IRAK110O04 pCMV-SPORT6 BC050742 NM_005926 Full
HGY091119 IRAL027N07 pOTB7 BC023557 NM_005926 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR322979 RBb07H11 pKA1U5 NM_005926.2  
TGTCTTCTCTTCGTTGACGTTGCTGGTGTTCACTGTTTTGGAATTAGTCAAGTTTCGGGA
HKR380478 RBd51D06 pGCAP10 NM_005926.2  
GCTCGTCACGTATTTCCGGTTTATCTAGCTCAGCCGTAAGTAGTTTCTCTATCAGTCGCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl