Prev. |  KEGG KO K09261 > 

RIKEN DNA Bank Human Resource - BORCS8-MEF2B

Gene ID NCBI Gene 4207 |  KEGG hsa:4207
Gene Symbol BORCS8-MEF2B
Protein Name BORCS8-MEF2B readthrough
Synonyms LOC729991-MEF2B|MEF2B|MEF2BNB-MEF2B|RSRFR2
Ortholog resource in our bank

  BORCS8-MEF2B

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY080442 IRAL001B18 pOTB7 BC000489 NM_005919
HGY083753 IRAL009G09 pOTB7 BC000489 NM_005919
HGY091346 IRAL028G02 pOTB7 BC010178 NM_005919

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE011010 W01A027I18 pENTR-TOPO flj0076m22 AK128256 NM_005919  
HGE047566 W01A118P06 pENTR-TOPO IRAL028G02 BC010178 NM_005919  
HGE047572 W01A118P12 pENTR-TOPO IRAL028G02 BC010178 NM_005919  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR338012 RBb45A12 pGCAP1 NM_005919.2  
GGGCCGCGGTCGCTATGGAGGAGCCGGAGATGCAGCTCAAGGGGAAGAAAGTCACGGACA
HKR375253 RBd38C05 pGCAP10 NM_005919.2  
GGGGGCAGCGTACCTTGGCCGTCCCGTTCCACAACAAGGTCCCTTCTGCGGTCTCAAAGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl