Prev. |  KEGG KO K04007 > 

RIKEN DNA Bank Human Resource - CD46

Gene ID NCBI Gene 4179 |  KEGG hsa:4179
Gene Symbol CD46
Protein Name CD46 molecule
Synonyms AHUS2|MCP|MIC10|TLX|TRA2.10
Ortholog resource in our bank

  CD46

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB07583 pcDNA3.1(-)-hCD46

webcatalog20220516.tab


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY013317 IRAK033E21 pBluescriptR BC030594 NM_153826 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE006657 W01A016K17 pENTR-TOPO IRAK033E21 BC030594 NM_153826  
HGE006663 W01A016K23 pENTR-TOPO IRAK033E21 BC030594 NM_153826  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR168904 ARi22E08 pGCAP10 NM_002389.3  
GACTGGATGCTTTGTGAGTTGGGGATTGTTGCGTCCCATATCTGGACCCAGAAGGGACTT
HKR203401 ARiS008I09 pGCAP10 NM_002389.3  
GGTTGCGTCCCNNNNCTGGACCCAGAAGGGACTTCCCTGCTCGGCTGGCTCTCGGTTTCT
HKR238443 ARiS096B19 pGCAP10 NM_002389.3  
GACTGGATGCTTTGTGAGTTGGGGATTGTTGCGTCCCATATCTGGACCCAGAAGGGACTT
HKR405387 RBdS013H19 pGCAP10 NM_002389.3  
GACGCCCACCTGTCCTGCAGCACTGGATGCTTTGTGAGTTGGGGATTGTTGCGTCCCATA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl