Prev. |  KEGG KO K02541 > 

RIKEN DNA Bank Human Resource - MCM3

Gene ID NCBI Gene 4172 |  KEGG hsa:4172
Gene Symbol MCM3
Protein Name minichromosome maintenance complex component 3
Synonyms HCC5|P1-MCM3|P1.h|RLFB
Ortholog resource in our bank

  MCM3

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY083583 IRAL008P23 pOTB7 BC001626 NM_002388 Full
HGY085409 IRAL013I17 pOTB7 BC003509 NM_002388 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE025690 W01A064D18 pENTR-TOPO IRAL008P23 BC001626 NM_002388  
HGE025694 W01A064D22 pENTR-TOPO IRAL008P23 BC001626 NM_002388  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR080477 ARf01D05 pKA1U5 NM_002388.3  
ATCCTGGGGAGTCATCCTGGGAACCTCCACGCGACTTTGGTGGAGGTAGTTCTTTGGCAG
HKR184853 ARi62C05 pGCAP10 NM_002388.3  
CGGCCGGCCGATGATCCTGGGAACCTCCACGCGACTTTGGTGGAGGTAGTTCTTTGGCAG
HKR329348 RBb23G04 pGCAP1 NM_002388.3  
TGGCGCCGGGGTGGAGTCATCCTGGGAACCTCCACGCGACTTTGGTGGAGGTAGTTCTTT
HKR452959 RBdS132G15 pGCAP10 NM_002388.3  
GGGGAACCTCCACGCGACTTTGGTGGAGGTAGTTCTTTGGCAGCGGGCATGGCGGGTACC
HKR474842 RBdS187B18 pGCAP10 NM_002388.3  
GGCCGGGGTGGAGTCATCCTGGGAACCTCCACGCGACTTTGGTGGAGGTAGTTCTTTGGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl