Prev. |  KEGG KO K02540 > 

RIKEN DNA Bank Human Resource - MCM2

Gene ID NCBI Gene 4171 |  KEGG hsa:4171
Gene Symbol MCM2
Protein Name minichromosome maintenance complex component 2
Synonyms BM28|CCNL1|CDCL1|D3S3194|DFNA70|MITOTIN|cdc19
Ortholog resource in our bank

  MCM2

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY080455 IRAL001C07 pOTB7 BC000300 NM_004526 Partial
HGY081636 IRAL004B12 pOTB7 BC007670 NM_004526 Full
HGY085644 IRAL014B20 pOTB7 BC014272 NM_004526 Full
HGY087533 IRAL018N21 pOTB7 BC006165 NM_004526 Full/var
HGY088118 IRAL020E22 pOTB7 BC030131 NM_004526 Partial
HGY088170 IRAL020H02 pOTB7 BC007938 NM_004526 Full
HGY089513 IRAL023N01 pOTB7 BC017490 NM_004526 Full
HGY095618 IRAL039A18 pOTB7 BC017258 NM_004526 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE003220 W01A008A20 pENTR-TOPO IRAL014B20 BC014272 NM_004526  
HGE003222 W01A008A22 pENTR-TOPO IRAL014B20 BC014272 NM_004526  
HGE003252 W01A008C04 pENTR-TOPO IRAL014B20 BC014272 NM_004526  
HGE003256 W01A008C08 pENTR-TOPO IRAL014B20 BC014272 NM_004526  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR222293 ARiS055M05 pGCAP10 NM_004526.2  
GGTACTGCTATGGCGGAATCATCGGAATCCTTCACCATGGCATCCAGCCCGGCCCAGCGT
HKR235141 ARiS087O05 pGCAP10 NM_004526.2  
GAGTGGCGGAGAGGATCGTGGTACTGCTATGGCGGAATCATCGGAATCCTTCACCATGGC
HKR338528 RBb46F08 pGCAP1 NM_004526.2  
TGGTTGTTGCTGTAGCTGGCGGAGAGGATCGCTGGTACTGCTATGGCGGAATCATCGGAA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


No Approval Forms Required for Fluorescent Protein Genes Developed by Dr. Atsushi Miyawaki
♦ RIKEN BRC will be closed from December 28, 2024 through January 5, 2025 due to New Year's holidays.
A bicistronic cell cycle reporter, Fucci2a (Sep 17, 2024)
Monomeric Fluorescent Protein Resource, mStayGold (Dec 18, 2023)
Visualization of Organelles update (Dec 18, 2023)
Development of two mouse strains conditionally expressing bright luciferases (Sep 08, 2023)
Autophagy and Mitophagy Updates (Aug 16, 2023)
High intensity forms of luciferase and luminescent proteins from various organisms (BRC RESOURCE NEWS) (Apr 28, 2023)
Plasmid of Cas9 expression/mRNA production, evaluation of the genome edit efficiency, and Knock-in donors and tags
Fucci cell cycle indicator, Calcium sensor and Fluorescent and Luminescent protein resources
Revision of Distribution Fees for Bioresources in RIKEN BRC
- - - - - - - - - - - - - - - - - - - -
Mail News sign-up. Receive information of the forcusd resources, new available resources and more.
♦ Please visit "Terms of Use", "Quality control" and "Ordering instruction"
Dnaconda's recommendation BRC Resource News RIKEN BRC 20th RIKEN BRC News sign-up

2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl