RIKEN DNA Bank Human Resource

RIKEN DNA Bank Human Resource - MCL1

Gene ID	NCBI Gene 4170 \| KEGG hsa:4170
Gene Symbol	MCL1
Protein Name	MCL1 apoptosis regulator, BCL2 family member
Synonyms	BCL2L3\|EAT\|MCL1-ES\|MCL1L\|MCL1S\|Mcl-1\|TM\|bcl2-L-3\|mcl1/EAT
Featured content	Jak-STAT signaling pathway (human)
Featured content	Apoptosis - human

Ortholog resource in our bank

  MCL1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number	Clone name	Vector	Sequence submitted (DDBJ)⁽¹⁾	CDS comparison
Catalog number	Clone name	Vector	Sequence submitted (DDBJ)⁽¹⁾	Refered (NCBI mRNA)	CDS status⁽²⁾
HGY081965	IRAL004P05	pOTB7	BC017197	NM_021960	Full
HGY103546	IRAL058O10	pOTB7	BC071897	NM_021960	Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number	Clone name	Vector	CDS comparison
	Clone name	Vector	Refered mRNA⁽¹⁾	CDS status
	5'-terminal sequence⁽²⁾
HKR243680	ARiS109D08	pGCAP10	NM_021960.3
HKR243680	GGCCCTAAAACCGTGATAAAGGAGCTGCTCGCCACTTCTCACTTCCGCTTCCTTCCAGTA
HKR398975	RBd97H07	pGCAP10	NM_021960.3
HKR398975	GACTTCTCACTTCCGCTTCCTTCCAGTAAGGAGTCGGGGTCTTCCCCAGTTTTCTCAGCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl