Prev. | Human A to Z list > M > 

RIKEN DNA Bank Human Resource - MCL1

Gene ID (NCBI) 4170
Gene Symbol MCL1
Protein Name MCL1, BCL2 family apoptosis regulator
Synonyms BCL2L3|EAT|MCL1-ES|MCL1L|MCL1S|Mcl-1|TM|bcl2-L-3|mcl1/EAT
Databases KEGG hsa:4170 |  NCBI Gene 4170
Featured content Jak-STAT signaling pathway (human)
Featured content Ortholog resources in the DNA Bank (KEGG orthology K02539)


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGY081965 IRAL004P05 pOTB7 BC017197 NM_021960 Full
HGY103546 IRAL058O10 pOTB7 BC071897 NM_021960 Full

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_170405.csv
GNP_full_IRAL_170405.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR243680 ARiS109D08 pGCAP10 NM_021960.3  
GGCCCTAAAACCGTGATAAAGGAGCTGCTCGCCACTTCTCACTTCCGCTTCCTTCCAGTA
HKR398975 RBd97H07 pGCAP10 NM_021960.3  
GACTTCTCACTTCCGCTTCCTTCCAGTAAGGAGTCGGGGTCTTCCCCAGTTTTCTCAGCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2018.03.01

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_180123.pl