Prev. |  KEGG KO K11589 > 

RIKEN DNA Bank Human Resource - MBD1

Gene ID NCBI Gene 4152 |  KEGG hsa:4152
Gene Symbol MBD1
Protein Name methyl-CpG binding domain protein 1
Synonyms CXXC3|PCM1|RFT
Ortholog resource in our bank

  MBD1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB08344 pEGFP-MBD-nls Methylated DNA probe. Expression clone of methylated DNA binding domain (MBD) of human MBD1.

webcatalog20220516.tab


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY097490 IRAL043M02 pOTB7 BC033242 NM_015844 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR009610 ARa24A10 pKA1U5 NM_002384.2  
GGGAGGCGACAGCTACCGCTTCAGAGGAGGCGGCCGCGGAGGAGGAGGAAGGGGAGGAGG
HKR462576 RBdS156H08 pGCAP10 NM_002384.2  
GAGGTNNANGAGGNNCCCTCGNCNTGGGTCCACGGGCCTAGAGTGGCGGAAGATACCGGC
HKR462770 RBdS156P10 pGCAP10 NM_002384.2  
GGCATGCGCCAGCTAGATGGGCAGCGAGGAGAGCCGCAACTGCCAGTCCCTCGAAGGGGT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl