Prev. |  KEGG KO K01874 > 

RIKEN DNA Bank Human Resource - MARS1

Gene ID NCBI Gene 4141 |  KEGG hsa:4141
Gene Symbol MARS1
Protein Name methionyl-tRNA synthetase 1
Synonyms CMT2U|ILFS2|ILLD|MARS|METRS|MRS|MTRNS|SPG70
Ortholog resource in our bank

  MARS1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB13272 pUC-T7-EMCV-GST-MetRS EMCV IRES-dependent expression vector of human methionyl-tRNA synthetase

webcatalog20220516.tab


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY080725 IRAL001N13 pOTB7 BC002384 NM_004990 Full
HGY086913 IRAL017E17 pOTB7 BC011639 NM_004990 Full
HGY087063 IRAL017K23 pOTB7 BC006328 NM_004990 Full
HGY091441 IRAL028K01 pOTB7 BC011849 NM_004990 Full
HGY100126 IRAL050F06 pOTB7 BC065187 NM_004990 Full/var
HGY093801 IRAL034I09 pOTB7 BC015011 NM_004990 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2022Apr03.csv
GNP_full_IRAL_2022Apr03.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE099606 M01C049A06 pDONR221 MGC14-B03 BC002384 NM_004990  
HGE099654 M01C049C06 pDONR221 MGC14-B03 BC002384 NM_004990  
HGE099702 M01C049E06 pDONR221 MGC14-B03 BC002384 NM_004990  
HGE099750 M01C049G06 pDONR221 MGC14-B03 BC002384 NM_004990  
HGE099798 M01C049I06 pDONR221 MGC14-B03 BC002384 NM_004990  
HGE099846 M01C049K06 pDONR221 MGC14-B03 BC002384 NM_004990  
HGE099894 M01C049M06 pDONR221 MGC14-B03 BC002384 NM_004990  
HGE099942 M01C049O06 pDONR221 MGC14-B03 BC002384 NM_004990  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2022Apr03.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR169236 ARi23B12 pGCAP10 NM_004990.2  
TGGGCATCAGCGAGGGATTCACGGCGAAATGAGACTGTTCGTGAGTGATGGCGTCCCGGG
HKR343706 RBb59E10 pGCAP1 NM_004990.2  
AGAAGCGGGAGGCCGGTTCCGGTTGCATCAGCGAGGGATTCACGGCGAAATGAGACTGTT
HKR441770 RBdS104H02 pGCAP10 NM_004990.2  
GATCAGCGAGGNATTCACGGCGAAATGAGACTGTTCGTGAGTGATGGCGTCCCGGGTTGC
HKR470853 RBdS177C05 pGCAP10 NM_004990.2  
GGGGAGGCCGGTTCCGGTTGCATCAGCGAGGGATTCACGGCGAAATGAGACTGTTCGTGA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2022Apr03.csv
NRCDhumcloneList_RB_2022Apr03.csv


2022.05.18

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_220215.pl