Prev. | Human A to Z list > M > 

RIKEN DNA Bank Human Resource - MARK3

Gene ID (NCBI) 4140
Gene Symbol MARK3
Protein Name MAP/microtubule affinity-regulating kinase 3
Synonyms CTAK1|KP78|PAR1A|Par-1a
Databases KEGG link 01 |  NCBI Gene link 01
Featured content Kinases Included in Myristoylated Kinase Library (human) in Boehm JS Cell 129 (6):1065-1079 (2007). PMID: 17574021.


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB04916 SEREX clone NGO-Pr-7 (ID 600, 601) #1 SEREX clone NGO-Pr-7 (ID 600, 601) #1

RDB_hum_161122.csv


NRCD Human Full-Legth cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR323724 RBb09F04 pKA1U5 NM_002376.5  
GAGGCAGCAGAGGAAGCCGAGGGGCGGCCATCTTGGCTCCGTGAGGCTCTGAGGTGCCGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2016.12.28

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_161013.pl