RIKEN DNA Bank Human Resource

RIKEN DNA Bank Human Resource - MARK3

Gene ID	NCBI Gene 4140 \| KEGG hsa:4140
Gene Symbol	MARK3
Protein Name	microtubule affinity regulating kinase 3
Synonyms	CTAK1\|KP78\|PAR1A\|Par-1a\|VIPB
Featured content	Kinases Included in Myristoylated Kinase Library (human) in Boehm JS Cell 129 (6):1065-1079 (2007). PMID: 17574021.

Ortholog resource in our bank

  MARK3

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Individualy Deposited Resource

Catalog number	Name of Resource	Description
RDB04916	SEREX clone NGO-Pr-7 (ID 600, 601) #1	SEREX clone NGO-Pr-7 (ID 600, 601) #1

webcatalog20220516.tab

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number	Clone name	Vector	CDS comparison
	Clone name	Vector	Refered mRNA⁽¹⁾	CDS status
	5'-terminal sequence⁽²⁾
HKR323724	RBb09F04	pKA1U5	NM_001128919.3	Full
HKR323724	GAGGCAGCAGAGGAAGCCGAGGGGCGGCCATCTTGGCTCCGTGAGGCTCTGAGGTGCCGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl