Prev. |  KEGG KO K08798 > 

RIKEN DNA Bank Human Resource - MARK3

Gene ID NCBI Gene 4140 |  KEGG hsa:4140
Gene Symbol MARK3
Protein Name microtubule affinity regulating kinase 3
Synonyms CTAK1|KP78|PAR1A|Par-1a|VIPB
Featured content Kinases Included in Myristoylated Kinase Library (human) in Boehm JS Cell 129 (6):1065-1079 (2007). PMID: 17574021.
Ortholog resource in our bank

  MARK3

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB04916 SEREX clone NGO-Pr-7 (ID 600, 601) #1 SEREX clone NGO-Pr-7 (ID 600, 601) #1

webcatalog20220516.tab


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR323724 RBb09F04 pKA1U5 NM_002376.5  
GAGGCAGCAGAGGAAGCCGAGGGGCGGCCATCTTGGCTCCGTGAGGCTCTGAGGTGCCGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2022Apr03.csv
NRCDhumcloneList_RB_2022Apr03.csv


2022.05.19

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_220215.pl