Prev. |  KEGG KO K12311 > 

RIKEN DNA Bank Human Resource - MAN2B1

Gene ID NCBI Gene 4125 |  KEGG hsa:4125
Gene Symbol MAN2B1
Protein Name mannosidase alpha class 2B member 1
Synonyms LAMAN|MANB
Featured content Lysosome (human)
Ortholog resource in our bank

  MAN2B1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY082813 IRAL007A13 pOTB7 BC000736 NM_000528 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE097240 M01C043B16 pDONR221 MGC11-D08 BC000736 NM_000528  
HGE097288 M01C043D16 pDONR221 MGC11-D08 BC000736 NM_000528  
HGE097336 M01C043F16 pDONR221 MGC11-D08 BC000736 NM_000528  
HGE097384 M01C043H16 pDONR221 MGC11-D08 BC000736 NM_000528  
HGE097432 M01C043J16 pDONR221 MGC11-D08 BC000736 NM_000528  
HGE097480 M01C043L16 pDONR221 MGC11-D08 BC000736 NM_000528  
HGE097528 M01C043N16 pDONR221 MGC11-D08 BC000736 NM_000528  
HGE097576 M01C043P16 pDONR221 MGC11-D08 BC000736 NM_000528  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR162408 ARi06A08 pGCAP10 NM_000528.3  
GGCCGGGTCTGGGGGCGGGGCGTTTGCCCGGCCTTTCCAGGGCCGGGGAACCCCAGGAGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl