Prev. | Human A to Z list > M > 

RIKEN DNA Bank Human Resource - MAN2B1

Gene ID (NCBI) 4125
Gene Symbol MAN2B1
Protein Name mannosidase, alpha, class 2B, member 1
Synonyms LAMAN|MANB
Databases KEGG link 01 |  NCBI Gene link 01
Featured content Lysosome (human)


Genome Network Project (GNP) Human Full-Length cDNA Clone link 01

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGY082813 IRAL007A13 pOTB7 BC000736 NM_000528 Full

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_160505.csv
GNP_full_IRAL_160505.csv


Genome Network Project (GNP) Gateway® Entry Clone link 01

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE097240 M01C043B16 pDONR221 MGC11-D08 BC000736 NM_000528  
HGE097288 M01C043D16 pDONR221 MGC11-D08 BC000736 NM_000528  
HGE097336 M01C043F16 pDONR221 MGC11-D08 BC000736 NM_000528  
HGE097384 M01C043H16 pDONR221 MGC11-D08 BC000736 NM_000528  
HGE097432 M01C043J16 pDONR221 MGC11-D08 BC000736 NM_000528  
HGE097480 M01C043L16 pDONR221 MGC11-D08 BC000736 NM_000528  
HGE097528 M01C043N16 pDONR221 MGC11-D08 BC000736 NM_000528  
HGE097576 M01C043P16 pDONR221 MGC11-D08 BC000736 NM_000528  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com/site/us/en/home.html


NRCD Human Full-Legth cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR162408 ARi06A08 pGCAP10 NM_000528.3  
GGCCGGGTCTGGGGGCGGGGCGTTTGCCCGGCCTTTCCAGGGCCGGGGAACCCCAGGAGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2016.11.19

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_161013.pl