Prev. |  KEGG KO K04677 > 

RIKEN DNA Bank Human Resource - SMAD6

Gene ID NCBI Gene 4091 |  KEGG hsa:4091
Gene Symbol SMAD6
Protein Name SMAD family member 6
Synonyms AOVD2|HsT17432|MADH6|MADH7
Ortholog resource in our bank

  SMAD6

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY089635 IRAL024B11 pOTB7 BC012986 NM_005585 Full
HGY098916 IRAL047E20 pOTB7 BC052569 NM_005585

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE018403 W01A046A03 pENTR-TOPO IRAL024B11 BC012986 NM_005585  
HGE018405 W01A046A05 pENTR-TOPO IRAL024B11 BC012986 NM_005585  
HGE018409 W01A046A09 pENTR-TOPO IRAL024B11 BC012986 NM_005585 done

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR343754 RBb59G10 pGCAP1 NM_005585.3  
GGAGCGATCGAGGGAGCTGAGCCGAGAGAAAGAGCCGCCGGGCGCTGCCTCGCCAGACCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl