Prev. |  KEGG KO K04501 > 

RIKEN DNA Bank Human Resource - SMAD4

Gene ID NCBI Gene 4089 |  KEGG hsa:4089
Gene Symbol SMAD4
Protein Name SMAD family member 4
Synonyms DPC4|JIP|MADH4|MYHRS
Featured content Signaling pathways regulating pluripotency of stem cells (human)
Featured content Hippo signaling (human)
Featured content Wnt signaling pathway (human)
Ortholog resource in our bank

  SMAD4

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Individualy Deposited Resource

Catalog number Name of Resource Description
RDB02008 AxCAhDPC4 (frame-shift) Recombinant adenovirus expressing human DPC4 (=Smad4) regulated by CAG promoter
RDB02009 pAxCAhDPC4 (frame-shift) Shuttle vector to generate rAd expressing human DPC4 (=Smad4)
RDB02854 Smad4-pcDNA1.1Amp Expression vector of human SMAD4
RDB07733 pGL4-phSMAD4(MADH4) Promoter collection, Human SMAD4 promoter

webcatalog20220516.tab

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY080681 IRAL001L17 pOTB7 BC002379 NM_005359

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Jun29.csv
GNP_full_IRAL_2023Jun29.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE002746 W01A006O10 pENTR-TOPO IRAL001L17 BC002379 NM_005359  
HGE002748 W01A006O12 pENTR-TOPO IRAL001L17 BC002379 NM_005359  
HGE002752 W01A006O16 pENTR-TOPO IRAL001L17 BC002379 NM_005359  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR051352 ARe28G08 pKA1U5 NM_005359.5  
TGGGCTTCTCGACAAGTTGGCAGCAACAACACGGCCTTGGATCGTCGTCGCCGCTGCGGT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.11.09

Homo_sapiens_gene_info230514.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl