Prev. | Human A to Z list > S > 

RIKEN DNA Bank Human Resource - SMAD2

Gene ID (NCBI) 4087
Gene Symbol SMAD2
Protein Name SMAD family member 2
Synonyms JV18|JV18-1|MADH2|MADR2|hMAD-2|hSMAD2
Databases KEGG hsa:4087 |  NCBI Gene 4087
Featured content Signaling pathways regulating pluripotency of stem cells (human)
Featured content Hippo signaling (human)
Featured content Endocytosis (human)
Featured content Ortholog resources in the DNA Bank (KEGG orthology K04500)


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB04101 pAxCALNLhMADH2 Shuttle vector to generate rAd harboring human MADH2
RDB03519 pAxCALNLhMADH2 (forward) Shuttle vector to generate rAd harboring human MADH2 (forward)
RDB07000 pCMFlag_hsSMAD2 Expression vector of human SMAD2
RDB07284 pAxEFFlag_hsSMAD2it2 Shuttle vector to generate rAd harboring human SMAD2

RDB_org_170226.csv


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGX011209 IRAK028A09 pCMV-SPORT6 BC014840 NM_005901 Full
HGX019851 IRAK049K11 pCMV-SPORT6 BC025699 NM_005901 Full

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_170405.csv
GNP_full_IRAL_170405.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR042922 ARe07F02 pKA1U5 NM_005901.4  
GACCCGCGCGGCCGCGGCGGCGGAGAAGCAGCTCGCCAGCCAGCAGCCCGCCAGCCGCCG
HKR379227 RBd48B03 pGCAP10 NM_005901.4  
GGGAGAAGCAGCTCGCCAGCCAGCAGCCCGCCAGCCGCCGGGAGCCCCCTCCATCCCATC
HKR441822 RBdS104J06 pGCAP10 NM_005901.4  
TGGCCCGCGGCCCAGGGTGGCAGGCGGGTCTACCCGCGCGGCCGCGGCGGCGGAGAAGCA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2018.06.07

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_180123.pl