DNA Bank Top |  KEGG KO K04500 > 

RIKEN DNA Bank Human Resource - SMAD2

Gene ID NCBI Gene 4087 |  KEGG hsa:4087
Gene Symbol SMAD2
Protein Name SMAD family member 2
Synonyms CHTD8|JV18|JV18-1|LDS6|MADH2|MADR2|hMAD-2|hSMAD2
Featured content Signaling pathways regulating pluripotency of stem cells (human)
Featured content Hippo signaling (human)
Featured content Endocytosis (human)

Link

Ortholog resource in our bank

  SMAD2

External database

human SMAD2

Individualy Deposited Resource

Catalog number Name of Resource Description CDS comparison
Refered (NCBI mRNA) CDS status(1)
RDB07284 pAxEFFlag_hsSMAD2it2 Shuttle vector to generate rAd harboring human SMAD2    
RDB07000 pCMFlag_hsSMAD2 Expression vector of human SMAD2.    
RDB04101 pAxCALNLhMADH2 (reverse) Shuttle vector to generate rAd harboring human MADH2    
RDB03519 pAxCALNLhMADH2 (forward) Shuttle vector to generate rAd harboring human MADH2 (forward)    

(1) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.

webcatalog20240727.tab

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX019851 IRAK049K11 pCMV-SPORT6 BC025699 NM_005901 Full
HGX011209 IRAK028A09 pCMV-SPORT6 BC014840 NM_005901 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2024May11.csv
GNP_full_IRAL_2024May11.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR042922 ARe07F02 pKA1U5 NM_005901.4  
GACCCGCGCGGCCGCGGCGGCGGAGAAGCAGCTCGCCAGCCAGCAGCCCGCCAGCCGCCG
HKR379227 RBd48B03 pGCAP10 NM_005901.4  
GGGAGAAGCAGCTCGCCAGCCAGCAGCCCGCCAGCCGCCGGGAGCCCCCTCCATCCCATC
HKR441822 RBdS104J06 pGCAP10 NM_005901.4  
TGGCCCGCGGCCCAGGGTGGCAGGCGGGTCTACCCGCGCGGCCGCGGCGGCGGAGAAGCA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2024May11.csv
NRCDhumcloneList_RB_2024May11.csv

2024.10.02

Homo_sapiens_gene_info230514.csv - RDB_hum_GIxxxxxxxxx_html_240727.pl