RIKEN DNA Bank Human Resource

RIKEN DNA Bank Human Resource - MAD2L1

Gene ID	NCBI Gene 4085 \| KEGG hsa:4085
Gene Symbol	MAD2L1
Protein Name	mitotic arrest deficient 2 like 1
Synonyms	HSMAD2\|MAD2

Ortholog resource in our bank

  MAD2L1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number	Clone name	Vector	Sequence submitted (DDBJ)⁽¹⁾	CDS comparison
Catalog number	Clone name	Vector	Sequence submitted (DDBJ)⁽¹⁾	Refered (NCBI mRNA)	CDS status⁽²⁾
HGY080741	IRAL001O05	pOTB7	BC000356	NM_002358	Full
HGY088729	IRAL021N17	pDNR-LIB	BC005945	NM_002358	Full
HGY103072	IRAL057L08	pDNR-LIB	BC070283	NM_002358	Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number	Clone name	Vector	CDS comparison
	Clone name	Vector	Refered mRNA⁽¹⁾	CDS status
	5'-terminal sequence⁽²⁾
HKR064929	ARe62F09	pKA1U5	NM_002358.2
HKR064929	TGGGGGAAGTGCTGTTGGAGCCGCTGTGGTTGCTGTCCGCGGAGTGGAAGCGCGTGCTTT
HKR364058	RBd10C10	pGCAP10	NM_002358.2
HKR364058	TGGCTGTGGTTGCTGTCCGCGGAGTGGAAGCGCGTGCTTTTGTTTGTGTCCCTGGCCATG
HKR452943	RBdS132F23	pGCAP10	NM_002358.2
HKR452943	GGAAACGCTTGGCGGGGAAGTGCTGTTGGAGCCGCTGTGGTTGCTGTCCGCGGAGTGGAA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl