Prev. |  KEGG KO K10089 > 

RIKEN DNA Bank Human Resource - M6PR

Gene ID NCBI Gene 4074 |  KEGG hsa:4074
Gene Symbol M6PR
Protein Name mannose-6-phosphate receptor, cation dependent
Synonyms CD-M6PR|CD-MPR|MPR 46|MPR-46|MPR46|SMPR
Featured content Lysosome (human)
Featured content Lectin - human
Ortholog resource in our bank

  M6PR

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY084665 IRAL011L01 pOTB7 BC024206 NM_002355 Full
HGY089542 IRAL023O06 pOTB7 BC017111 NM_002355 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR392530 RBd81F10 pGCAP10 NM_002355.2  
GACCCGGGAGCGGTCAGGCGCGTGACCCCGCGTGACCGGGGTGCGCGAGCCGAGAGGCCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl