Prev. | 

RIKEN DNA Bank Human Resource - TM4SF1

Gene ID NCBI Gene 4071 |  KEGG hsa:4071
Gene Symbol TM4SF1
Protein Name transmembrane 4 L six family member 1
Synonyms H-L6|L6|M3S1|TAAL6
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB04187 pCAhL6 Expression vector of human L6/TM4SF1
RDB04188 pAx3CAhL6 Shuttle vector to generate rAd expressing human L6/TM4SF1
RDB04189 Ax3CAhL6 Recombinant adenovirus expressing human L6/TM4SF1

webcatalog20220516.tab


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY088671 IRAL021L07 pDNR-LIB BC008442 NM_014220 Full
HGY091077 IRAL027L13 pOTB7 BC010166 NM_014220 Full
HGY096562 IRAL041G18 pDNR-LIB BC034145 NM_014220 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Jun29.csv
GNP_full_IRAL_2023Jun29.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR040430 ARe01B06 pKA1U5 NM_014220.2  
GGTGGTGTTTGCTTTCTCCACCAGAAGGGCACACTTTCATCTAATTTGGGGTATCACTGA
HKR047306 ARe18E10 pKA1U5 NM_014220.2  
TGTGGTGGTGTTTGCTTTCTCCACCAGAAGGGCACACTTTTCATCTAATTTGGGGTATCA
HKR065731 ARe64F11 pKA1U5 NM_014220.2  
GAGTGGTGTTTGCTTTCTCCACCAGAAGGGCACACTTTCATCTAATTTGGGGTATCACTG
HKR070426 ARe76B02 pKA1U5 NM_014220.2  
GGATTAGGACCAATGAAAGCAAAGTACCTCATCCCCNTCAGTGACTAAGAATCGCAGTAT
HKR075236 ARe88B12 pKA1U5 NM_014220.2  
GAGTATTTAAGAGGTAGCAGGAATGGGCTGAGAGTGGTGTTTGCTTTCTCCACCAGAAGG
HKR075704 ARe89E08 pKA1U5 NM_014220.2  
ATCCTGGGGTGTTTGCTTTCTCCACCAGAAGGGCACACTTTCATCTAATTTGGGGTATCA
HKR075728 ARe89F08 pKA1U5 NM_014220.2  
ATCCTGGGGTGTTTGCTTTCTCCACCAGAAGGGCACACTTTCATCTAATTTGGGGTATCA
HKR166552 ARi16G08 pGCAP10 NM_014220.2  
GGGTGTTTGCTTTCTCCACCAGAAGGGCACACTTTCATCTAATTTGGGGTATCACTGAGC
HKR168908 ARi22E12 pGCAP10 NM_014220.2  
GGGTGTTTGCTTTCTCCACCAGAAGGGCACACTTTCATCTAATTTGGGGTATCACTGAGC
HKR173609 ARi34A09 pGCAP10 NM_014220.2  
GGTGGTGTTTGCTTTCTCCACCAGAAGGGCACACTTTCATCTAATTTGGGGTATCACTGA
HKR174979 ARi37H11 pGCAP10 NM_014220.2  
GGTGGTGTTTGCTTTCTCCACCAGAAGGGCACACTTTCATCTAATTTGGGGTATCACTGA
HKR176553 ARi41G09 pGCAP10 NM_014220.2  
GGTGGTGTTTGCTTTCTCCACCAGAAGGGCACACTTTCATCTAATTTGGGGTATCACTGA
HKR179747 ARi49G03 pGCAP10 NM_014220.2  
GGGTGTTTGCTTTCTCCACCAGAAGGGCACACTTTCATCTAATTTGGGGTATCACTGAGC
HKR180499 ARi51E03 pGCAP10 NM_014220.2  
GGTGTGTTTGCTTTCTCCACCAGAAGGGCACACTTTCATCTAATTTGGGGTATCACTGAG
HKR182576 ARi56H08 pGCAP10 NM_014220.2  
GTGTTTGCTTTCTCCACCAGAAGGGCACACTTTCATCTAATTTGGGGTATCACTGAGCTG
HKR203237 ARiS008B13 pGCAP10 NM_014220.2  
GGGTGTTTGCTTTCTCCACCAGAAGGGCACACTTTCATCTAATTTGGGGTATCACTGAGC
HKR218089 ARiS045D17 pGCAP10 NM_014220.2  
GGTGGTGTTTGCTTTCTCCACCAGAAGGGCACACTTTCATCTAATTTGGGGTATCACTGA
HKR238744 ARiS096O08 pGCAP10 NM_014220.2  
GGGTGTTTGCTTTCTCCACCAGAAGGGCACACTTTCATCTAATTTGGGGTATCACTGAGC
HKR243877 ARiS109L13 pGCAP10 NM_014220.2  
GGTGGTGTTTGCTTTCTCCACCAGAAGGGCACACTTTCATCTAATTTGGGGTATCACTGA
HKR247400 ARiS118I08 pGCAP10 NM_014220.2  
GGTGGTGTTTGCTTTCTCCACCAGAAGGGCACACTTTCATCTAATTTGGGGTATCACTGA
HKR247425 ARiS118J09 pGCAP10 NM_014220.2  
GAGTGGTGTTTGCTTTCTCCACCAGAAGGGCACACTTTCATCTAATTTGGGGTATCACTG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.08.17

Homo_sapiens_gene_info230514.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl