Prev. | Human A to Z list > L > 

RIKEN DNA Bank Human Resource - LYN

Gene ID (NCBI) 4067
Gene Symbol LYN
Protein Name v-yes-1 Yamaguchi sarcoma viral related oncogene homolog
Synonyms JTK8|p53Lyn|p56Lyn
Databases KEGG link 01 |  NCBI Gene link 01
Featured content NF-kappa B signaling pathway (human)


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB01275 pLYP2.2 Plasmid clone of human LYN cDNA.
RDB01306 Lyn/pLY30 Plasmid clone of human LYN cDNA.
RDB01966 pME18S-Lyn Expression vector of human lyn cDNA (partial)
RDB02331 pAxCAhLyn (forward) Shuttle vector to produce rAd expressing human Lyn
RDB02332 pAxCAhLyn (reverse) Shuttle vector to produce rAd expressing human Lyn

RDB_hum_161122.csv


Genome Network Project (GNP) Human Full-Length cDNA Clone link 01

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGY067438 IRAK168J22 pBluescriptR BC068551 NM_002350 Full/var

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_160505.csv
GNP_full_IRAL_160505.csv


NRCD Human Full-Legth cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR178406 ARi46A06 pGCAP10 NM_002350.2  
TAGCTGGGACCTCTCGGCCGAGCCCAGAGACAGCCAGTTCCTCTCCCGCCGCGCCGGGCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2016.11.25

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_161013.pl