Prev. |  KEGG KO K05854 > 

RIKEN DNA Bank Human Resource - LYN

Gene ID NCBI Gene 4067 |  KEGG hsa:4067
Gene Symbol LYN
Protein Name LYN proto-oncogene, Src family tyrosine kinase
Synonyms JTK8|p53Lyn|p56Lyn
Featured content NF-kappa B signaling pathway (human)
Featured content B cell receptor signaling pathway (human)
Ortholog resource in our bank

  LYN

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB01306 Lyn/pLY30 Plasmid clone of human LYN cDNA.
RDB01966 pME18S-Lyn Expression vector of human lyn cDNA (partial)
RDB02331 pAxCAhLyn (forward) Shuttle vector to produce rAd expressing human Lyn
RDB02332 pAxCAhLyn (reverse) Shuttle vector to produce rAd expressing human Lyn
RDB19300 pF25AICET7_LYN Protein expresion vector of human LYN proto-oncogene for Promega TnT insect cell cell-free protein-synthesis system.
RDB19301 pF25AICET7_LYN_G2A Protein expresion vector of human LYN proto-oncogene on-N-myristoylated mutant (G2A) for Promega TnT insect cell cell-free protein-synthesis system.
RDB19302 pF25AICET7_LYN_S13A Protein expresion vector of human LYN proto-oncogene mutant (S13A) for Promega TnT insect cell cell-free protein-synthesis system.

webcatalog20220516.tab


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY067438 IRAK168J22 pBluescriptR BC068551 NM_002350 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Jun29.csv
GNP_full_IRAL_2023Jun29.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR178406 ARi46A06 pGCAP10 NM_002350.2  
TAGCTGGGACCTCTCGGCCGAGCCCAGAGACAGCCAGTTCCTCTCCCGCCGCGCCGGGCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.08.18

Homo_sapiens_gene_info230514.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl