Prev. |  KEGG KO K06578 > 

RIKEN DNA Bank Human Resource - BCAM

Gene ID NCBI Gene 4059 |  KEGG hsa:4059
Gene Symbol BCAM
Protein Name basal cell adhesion molecule (Lutheran blood group)
Synonyms AU|CD239|LU|MSK19
Ortholog resource in our bank

  BCAM

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX027448 IRAK068K08 pCMV-SPORT6 BC036745 NM_005581 Partial/var
HGX039317 IRAK098E21 pCMV-SPORT6 BC050450 NM_005581 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE020507 W01A051E11 pENTR-TOPO IRAK098E21 BC050450 NM_005581  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR040949 ARe02G05 pKA1U5 NM_005581.3  
GCTCCNCCGCCGCCGNGNACATGGNAGCCCCCGNCCCTNNNANGNNCCAGGCGCGCNGGG
HKR161721 ARi04F01 pGCAP10 NM_005581.3  
AGAGCCCCGCAGCGGCCGAGCTGCAGCCCGGGCTCAGTCTCCGCCGCCGCCGTGAACATG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl