Prev. |  KEGG KO K03159 > 

RIKEN DNA Bank Human Resource - LTBR

Gene ID NCBI Gene 4055 |  KEGG hsa:4055
Gene Symbol LTBR
Protein Name lymphotoxin beta receptor
Synonyms D12S370|LT-BETA-R|TNF-R-III|TNFCR|TNFR-RP|TNFR2-RP|TNFR3|TNFRSF3
Featured content NF-kappa B signaling pathway (human)
Featured content HIF-1 signaling pathway - human
Featured content Intestinal immune network for IgA production - human
Ortholog resource in our bank

  LTBR

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY094837 IRAL037B13 pDNR-LIB BC026262 NM_002342 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE037664 W01A094C16 pENTR-TOPO IRAL037B13 BC026262 NM_002342  
HGE037668 W01A094C20 pENTR-TOPO IRAL037B13 BC026262 NM_002342  
HGE037672 W01A094C24 pENTR-TOPO IRAL037B13 BC026262 NM_002342  
HGE037698 W01A094E02 pENTR-TOPO IRAL037B13 BC026262 NM_002342  
HGE037702 W01A094E06 pENTR-TOPO IRAL037B13 BC026262 NM_002342  
HGE037704 W01A094E08 pENTR-TOPO IRAL037B13 BC026262 NM_002342  
HGE047078 W01A117L14 pENTR-TOPO IRAL037B13 BC026262 NM_002342  
HGE047080 W01A117L16 pENTR-TOPO IRAL037B13 BC026262 NM_002342  
HGE047084 W01A117L20 pENTR-TOPO IRAL037B13 BC026262 NM_002342  
HGE047086 W01A117L22 pENTR-TOPO IRAL037B13 BC026262 NM_002342  
HGE047088 W01A117L24 pENTR-TOPO IRAL037B13 BC026262 NM_002342  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR056123 ARe40F03 pKA1U5 NM_002342.1  
TGGCCGTGGGAGCCCTGGAGGCCCGGCCTGGCCGCTTNCCGGCCCTGGGGTGCACATCGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl