Prev. |  KEGG KO K01254 > 

RIKEN DNA Bank Human Resource - LTA4H

Gene ID NCBI Gene 4048 |  KEGG hsa:4048
Gene Symbol LTA4H
Protein Name leukotriene A4 hydrolase
Synonyms -
Ortholog resource in our bank

  LTA4H

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX027763 IRAK069G19 pCMV-SPORT6 BC032528 NM_000895 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE094033 M01C035B09 pDONR221 MGC07-C05 BC032528 NM_000895  
HGE094081 M01C035D09 pDONR221 MGC07-C05 BC032528 NM_000895  
HGE094129 M01C035F09 pDONR221 MGC07-C05 BC032528 NM_000895  
HGE094177 M01C035H09 pDONR221 MGC07-C05 BC032528 NM_000895  
HGE094225 M01C035J09 pDONR221 MGC07-C05 BC032528 NM_000895  
HGE094273 M01C035L09 pDONR221 MGC07-C05 BC032528 NM_000895  
HGE094321 M01C035N09 pDONR221 MGC07-C05 BC032528 NM_000895  
HGE094369 M01C035P09 pDONR221 MGC07-C05 BC032528 NM_000895  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR072552 ARe81G08 pKA1U5 NM_000895.1  
TTGGAGGATCGACGAGTCTGGTAGCTGAGCGTTGGGCTGTAGGTCGCTGTGCTGTGTGAT
HKR163677 ARi09D05 pGCAP10 NM_000895.1  
GCTCTATCGACGAGTCTGGTAGCTGAGCGTTGGGCTGTAGGTCGCTGTGCTGTGTGATCC
HKR203582 ARiS008P22 pGCAP10 NM_000895.1  
GCTCCTGAGACTGGACCGTGAGAGCAGCAGTCCCGGTCAGCGTCCGGCGAGTAAAGTCGA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl