Prev. | Human A to Z list > L > 

RIKEN DNA Bank Human Resource - LMNB1

Gene ID (NCBI) 4001
Gene Symbol LMNB1
Protein Name lamin B1
Synonyms ADLD|LMN|LMN2|LMNB
Databases KEGG hsa:4001 |  NCBI Gene 4001
Featured content Ortholog resources in the DNA Bank (KEGG orthology K07611)


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGX069972 IRAK174P12 pCMV-SPORT6 BC078178 NM_005573 Partial/var

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_170405.csv
GNP_full_IRAL_170405.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE041456 W01A103K16 pENTR-TOPO IRAK003N23 BC012295 NM_005573 done
HGE041458 W01A103K18 pENTR-TOPO IRAK003N23 BC012295 NM_005573  
HGE041464 W01A103K24 pENTR-TOPO IRAK003N23 BC012295 NM_005573  
HGE041490 W01A103M02 pENTR-TOPO IRAK003N23 BC012295 NM_005573  
HGE041492 W01A103M04 pENTR-TOPO IRAK003N23 BC012295 NM_005573  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com/site/us/en/home.html


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR381746 RBd54G02 pGCAP10 NM_005573.2  
GGGAAACAAAGTGCTGCGAGCAGGAGACGGCGGCGGCGCGAACCCTGCTGGGCCTCCAGT
HKR384849 RBd62C01 pGCAP10 NM_005573.2  
GCCCCCCCCGCCCGCCGCTCCGTGCAGCCTGAGAGGAAACAAAGTGCTGCGAGCAGGAGA
HKR390899 RBd77E03 pGCAP10 NM_005573.2  
GAAAGTGCTGCGAGCAGGAGACGGCGGCGGCGCGAACCCTGCTGGGCCTCCAGTCACCCT
HKR462671 RBdS156L07 pGCAP10 NM_005573.2  
GTGAGAGGAAACAAAGTGCTGCGAGCAGGAGACGGCGGCGGCGCGAACCCTGCTGGGCCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2018.03.01

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_180123.pl