Prev. |  KEGG KO K07611 > 

RIKEN DNA Bank Human Resource - LMNB1

Gene ID NCBI Gene 4001 |  KEGG hsa:4001
Gene Symbol LMNB1
Protein Name lamin B1
Synonyms ADLD|LMN|LMN2|LMNB
Featured content Apoptosis - human
Ortholog resource in our bank

  LMNB1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX069972 IRAK174P12 pCMV-SPORT6 BC078178 NM_005573 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE041456 W01A103K16 pENTR-TOPO IRAK003N23 BC012295 NM_005573 done
HGE041458 W01A103K18 pENTR-TOPO IRAK003N23 BC012295 NM_005573  
HGE041464 W01A103K24 pENTR-TOPO IRAK003N23 BC012295 NM_005573  
HGE041490 W01A103M02 pENTR-TOPO IRAK003N23 BC012295 NM_005573  
HGE041492 W01A103M04 pENTR-TOPO IRAK003N23 BC012295 NM_005573  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR381746 RBd54G02 pGCAP10 NM_005573.2  
GGGAAACAAAGTGCTGCGAGCAGGAGACGGCGGCGGCGCGAACCCTGCTGGGCCTCCAGT
HKR384849 RBd62C01 pGCAP10 NM_005573.2  
GCCCCCCCCGCCCGCCGCTCCGTGCAGCCTGAGAGGAAACAAAGTGCTGCGAGCAGGAGA
HKR390899 RBd77E03 pGCAP10 NM_005573.2  
GAAAGTGCTGCGAGCAGGAGACGGCGGCGGCGCGAACCCTGCTGGGCCTCCAGTCACCCT
HKR462671 RBdS156L07 pGCAP10 NM_005573.2  
GTGAGAGGAAACAAAGTGCTGCGAGCAGGAGACGGCGGCGGCGCGAACCCTGCTGGGCCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl