DNA Bank Top |  KEGG KO K12641 > 

RIKEN DNA Bank Human Resource - LMNA

Gene ID NCBI Gene 4000 |  KEGG hsa:4000
Gene Symbol LMNA
Protein Name lamin A/C
Synonyms CDCD1|CDDC|CMD1A|CMT2B1|EMD2|FPL|FPLD|FPLD2|HGPS|IDC|LDP1|LFP|LGMD1B|LMN1|LMNC|LMNL1|MADA|PRO1
Featured content Apoptosis - human

Link

Ortholog resource in our bank

  LMNA


External database

human LMNA

Individualy Deposited Resource

Catalog number Name of Resource Description CDS comparison
Refered (NCBI mRNA) CDS status(1)
RDB04729 pAxCALNLhLaminA/C(reverse) Shuttle vector to generate rAd expressing human LMNA    
RDB04692 pAxCALNLhLaminA/C(forward) Shuttle vector to generate rAd expressing human LMNA    
RDB04066 pAxCALNLhLaminA/C (reverse) Shuttle vector to generate rAd harboring human LaminA/C (reverse)    
RDB04064 pAxCALNLhLaminA/C (reverse) Shuttle vector to generate rAd harboring human LaminA/C (reverse)    
RDB04056 pAxCALNLhLaminA/C (reverse) Shuttle vector to generate rAd expressing human Lamin A/C    
RDB03479 pAxCALNLhLaminA/C (forward) Shuttle vector to generate rAd harboring human LaminA/C (forward)    
RDB03476 pAxCALNLhLaminA/C (forward) Shuttle vector to generate rAd harboring human LaminA/C (forward)    
RDB03467 pAxCALNLhLaminA/C (forward) Shuttle vector to generate rAd harboring human LaminA/C (forward)    

(1) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.

webcatalog20240727.tab


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY083638 IRAL009B14 pOTB7 BC003162 NM_005572 Full
HGY093775 IRAL034H07 pOTB7 BC014507 NM_170707 Full
HGY097236 IRAL043B12 pOTB7 BC033088 NM_170708 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2024May11.csv
GNP_full_IRAL_2024May11.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE022444 W01A056B20 pENTR-TOPO flj0060a05 AK130179 NM_005572  
HGE030145 W01A075G01 pENTR-TOPO flj0060a05 AK130179 NM_005572  
HGE030153 W01A075G09 pENTR-TOPO flj0060a05 AK130179 NM_005572 done

♦ W series clone contains a stop codon.

GNP_entry_W01A_2024May11.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR055225 ARe38B01 pKA1U5 NM_170707.2  
GAGTGTTCGCGGGAGCGCCGCACCTACACCAGCCCAACCCAGATCCCGAGGTCCGACAGC
HKR056575 ARe41H07 pKA1U5 NM_170707.2  
GAGTGTTCGCGGGAGCGCCGCACCTACACCAGCCAATNCAGATCCCGAGGTCCGACAGCG
HKR067751 ARe69G07 pKA1U5 NM_170707.2  
TGGTGAGTGTTCGCGGGAGCGCCGCACCTACACCANCCAACCCAGATCCCGAGGTCCGAC
HKR082080 ARf05D08 pKA1U5 NM_170707.2  
GAGATCCCCACGCCTGCCAGGAGCAAGCCGAGAGCCAGCCGGCCGGCGCACTCCGACTCC
HKR203322 ARiS008F02 pGCAP10 NM_170707.2  
GGACAGCGCCCGGCCCAGATCCCCACGCCTGCCAGGAGCAAGCCGAGAGCCAGCCGGCCG
HKR264574 ARiS161H06 pGCAP10 NM_170707.2  
GAGTGTTCGCGGGAGCGCCGCACCTACACCAGCCAACCCAGATCCCGAGGTCCGACAGCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2024May11.csv
NRCDhumcloneList_RB_2024May11.csv


2024.09.27

Homo_sapiens_gene_info230514.csv - RDB_hum_GIxxxxxxxxx_html_240727.pl