Prev. |  KEGG KO K10080 > 

RIKEN DNA Bank Human Resource - LMAN1

Gene ID NCBI Gene 3998 |  KEGG hsa:3998
Gene Symbol LMAN1
Protein Name lectin, mannose binding 1
Synonyms ERGIC-53|ERGIC53|F5F8D|FMFD1|MCFD1|MR60|gp58
Featured content Lectin - human
Ortholog resource in our bank

  LMAN1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB19768 pMXs-IP spGFP-ERGIC53 Retroviral vector for stable expression of human ERGIC-53 with N-terminal GFP.

webcatalog20220516.tab


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX025706 IRAK064E10 pCMV-SPORT6 BC032330 NM_005570 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Jun29.csv
GNP_full_IRAL_2023Jun29.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE007486 W01A018L22 pENTR-TOPO IRAK064E10 BC032330 NM_005570  
HGE007488 W01A018L24 pENTR-TOPO IRAK064E10 BC032330 NM_005570  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR049332 ARe23F12 pKA1U5 NM_005570.3  
GAGAATCCAAGATGGCGGGATCCAGGCAAAGGGGTCTCCGGGCCAGAGTTCGGCCGCTGT
HKR051372 ARe28H04 pKA1U5 NM_005570.3  
GCTCCGCGTTCCAGAATCCAAGATGGCGGGATCCAGGCAAAGGGGTCTCCGGGCCAGAGT
HKR373279 RBd33D07 pGCAP10 NM_005570.3  
GAGAATCCAAGATGGCGGGATCCAGGCAAAGGGGTCTCCGGGCCAGAGTTCGGCCGCTGT
HKR375208 RBd38A08 pGCAP10 NM_005570.3  
TGGAGATCCAACGGAAAGTACCGACGAGATCAAAGAAGGGAAGACAGCAGGCGGGTGAGA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.07.02

Homo_sapiens_gene_info230514.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl