Prev. |  KEGG KO K10225 > 

RIKEN DNA Bank Human Resource - FADS3

Gene ID NCBI Gene 3995 |  KEGG hsa:3995
Gene Symbol FADS3
Protein Name fatty acid desaturase 3
Synonyms CYB5RP|LLCDL3
Ortholog resources KEGG ortholog (KEGG orthology K10225) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY084435 IRAL011B11 pOTB7 BC004901 NM_021727 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR051321 ARe28F01 pKA1U5 NM_021727.3  
ATCCTGGGGGGAGTTCCCTGCGCCGCGAGCCGGGAGGCGCACGCTCGCTCGTACGGCGGC
HKR171274 ARi28D02 pGCAP10 NM_021727.3  
TGGGGCGGCGGAGGCGGCGCCCGGGAGCGCTCTTCGCTTCCCTCGGGGTCTTGCTCGGAC
HKR172900 ARi32E04 pGCAP10 NM_021727.3  
TGGGGCGGCGGAGGCGGCGCCCGGGAGCGCTCTTCGCTTCCCTCGGGGTCTTGCTCGGAC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.18

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl