Prev. |  KEGG KO K01052 > 

RIKEN DNA Bank Human Resource - LIPA

Gene ID NCBI Gene 3988 |  KEGG hsa:3988
Gene Symbol LIPA
Protein Name lipase A, lysosomal acid type
Synonyms CESD|LAL
Featured content Lysosome (human)
Ortholog resource in our bank

  LIPA

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX001251 IRAK003C03 pCMV-SPORT6 BC012287 NM_000235 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR172881 ARi32D09 pGCAP10 NM_000235.2  
GACTGCGACTCGAGACAGCGGCCCGGCAGGACAGCTCCAGAATGAAAATGCGGTTCTTGG
HKR185779 ARi64H11 pGCAP10 NM_000235.2  
GCGCACCCCGGCCccTGAGAGCTGGcACTGCGACTCGAGACAGCGGCccggCAgGACAGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl