Prev. | Human A to Z list > L > 

RIKEN DNA Bank Human Resource - LIG1

Gene ID (NCBI) 3978
Gene Symbol LIG1
Protein Name DNA ligase 1
Synonyms -
Databases KEGG hsa:3978 |  NCBI Gene 3978
Featured content DNA repair (human)
Featured content Ortholog resources in the DNA Bank (KEGG orthology K10747)


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR081750 ARf04G06 pKA1U5 NM_000234.1  
GGGGACTGCAGAGGCGCGCCTGGCGGATCTGAGTGTGTTGCCCGGGCAGCGGCGCGCGGG
HKR260089 ARiS150D17 pGCAP10 NM_000234.1  
GGCNNNNNNGCNCCTGGCGGATCTGAGTGTGTTGCCCGGGCAGCGGCGCGCGGGACCAAC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2018.05.24

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_180123.pl