Prev. |  KEGG KO K10747 > 

RIKEN DNA Bank Human Resource - LIG1

Gene ID NCBI Gene 3978 |  KEGG hsa:3978
Gene Symbol LIG1
Protein Name DNA ligase 1
Synonyms -
Featured content DNA repair (human)
Ortholog resource in our bank

  LIG1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR081750 ARf04G06 pKA1U5 NM_000234.1  
GGGGACTGCAGAGGCGCGCCTGGCGGATCTGAGTGTGTTGCCCGGGCAGCGGCGCGCGGG
HKR260089 ARiS150D17 pGCAP10 NM_000234.1  
GGCNNNNNNGCNCCTGGCGGATCTGAGTGTGTTGCCCGGGCAGCGGCGCGCGGGACCAAC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl