DNA Bank Top |  KEGG KO K06832 > 

RIKEN DNA Bank Human Resource - LGALS8

Gene ID NCBI Gene 3964 |  KEGG hsa:3964
Gene Symbol LGALS8
Protein Name galectin 8
Synonyms Gal-8|PCTA-1|PCTA1|Po66-CBP
Featured content Lectin - human

Link

Ortholog resource in our bank

  LGALS8

External database

human LGALS8

Individualy Deposited Resource

Catalog number Name of Resource Description CDS comparison
Refered (NCBI mRNA) CDS status(1)
RDB08455 pET-G8Null-5a Bacteria expression vector of human galectin-8 with a truncated linker peptide (G8Null), tag-free protein    
RDB08454 pGEX-G8Null-1a Bacteria expression vector of human galectin-8 with a truncated linker peptide (G8Null), GST fusion protein    
RDB08414 pGEX-G8CCRD-1a Bacteria expression vector of human galectin-8 (C-terminal CRD, G8CCRD), GST fusion protein    
RDB08413 pGEX-G8NCRD-1a Bacteria expression vector of human galectin-8 (N-terminal CRD, G8NCRD), GST fusion protein    
RDB08412 pGEX-G8CT-1a Bacteria expression vector of human galectin-8 (C-terminal CRD with a part of the linker peptide, G8CT), GST fusion protein    
RDB08411 pGEX-G8NT-1a Bacteria expression vector of human galectin-8 (N-terminal CRD with a part of the linker peptide, G8NT), GST fusion protein    
RDB08410 pET-G8(L)-12a Bacteria expression vector of human galectin-8 with a long linker peptide (G8(L)/G8L), tag-free protein    
RDB08409 pGEX-G8(L) R197A-1a Bacteria expression vector of human galectin-8 with a long linker peptide (G8(L)/G8L) with an R197A mutation, GST fusion protein    
RDB08408 pGEX-G8(L) R69, 275H-1a Bacteria expression vector of human galectin-8 with a long linker peptide (G8(L)/G8L) with R69,275H mutations, GST fusion protein    
RDB08407 pGEX-G8(L) R275H-3a Bacteria expression vector of human galectin-8 with a long linker peptide (G8(L)/G8L) with an R275H mutation, GST fusion protein    
RDB08406 pGEX-G8(L) R69H-1a Bacteria expression vector of human galectin-8 with a long linker peptide (G8(L)/G8L) with an R69H mutation, GST fusion protein    
RDB08405 pGEX-G8(L)-1a Bacteria expression vector of human galectin-8 with a long linker peptide (G8(L)/G8L), GST fusion protein    
RDB08404 pET-G8(M)-1a Bacteria expression vector of human galectin-8 (the predominant isoform of G8 in most cell and tissue types, G8(M)/G8M), tag-free protein    
RDB08403 pGEX-G8(M) R69, 233H-1a Bacteria expression vector of human galectin-8 (the predominant isoform of G8 in most cell and tissue types, G8(M)/G8M) with R69,233H mutations, GST fusion protein    
RDB08402 pGEX-G8(M) R233H-2a Bacteria expression vector of human galectin-8 (the predominant isoform of G8 in most cell and tissue types, G8(M)/G8M) with an R233H mutation, GST fusion protein    
RDB08401 pGEX-G8(M) R69H-1a Bacteria expression vector of human galectin-8 (the predominant isoform of G8 in most cell and tissue types, G8(M)/G8M) with an R69H mutation, GST fusion protein    
RDB04222 pGEX-G8(M)-2a Bacteria expression vector of human galectin-8 (the predominant isoform of G8 in most cell and tissue types, G8(M)/G8M), GST fusion protein    

(1) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.

webcatalog20240727.tab

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX010488 IRAK026D16 pCMV-SPORT6 BC016486 NM_201544 Full
HGY087685 IRAL019D13 pDNR-LIB BC015818 NM_201545 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2024May11.csv
GNP_full_IRAL_2024May11.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE086018 M01C015A18 pDONR221 FLJ05-B09 BC016486 ENST00000356238  
HGE086066 M01C015C18 pDONR221 FLJ05-B09 BC016486 ENST00000356238  
HGE086114 M01C015E18 pDONR221 FLJ05-B09 BC016486 ENST00000356238  
HGE086162 M01C015G18 pDONR221 FLJ05-B09 BC016486 ENST00000356238  
HGE086210 M01C015I18 pDONR221 FLJ05-B09 BC016486 ENST00000356238  
HGE086258 M01C015K18 pDONR221 FLJ05-B09 BC016486 ENST00000356238  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2024May11.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR042883 ARe07D11 pKA1U5 NM_006499.3  
GGCCAGAGCCGGGAACCCTGTACGGCACTTAGCTGCTGACAAACAACCTGCTCCGTGGAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2024May11.csv
NRCDhumcloneList_RB_2024May11.csv

2024.09.26

Homo_sapiens_gene_info230514.csv - RDB_hum_GIxxxxxxxxx_html_240727.pl