DNA Bank Top |  KEGG KO K06831 > 

RIKEN DNA Bank Human Resource - LGALS3

Gene ID NCBI Gene 3958 |  KEGG hsa:3958
Gene Symbol LGALS3
Protein Name galectin 3
Synonyms CBP35|GAL3|GALBP|GALIG|L31|LGALS2|MAC2
Featured content Lectin - human

Link

Ortholog resource in our bank

  LGALS3

External database

human LGALS3

Individualy Deposited Resource

Catalog number Name of Resource Description CDS comparison
Refered (NCBI mRNA) CDS status(1)
RDB08395 pET-G3CRD-1a Bacteria expression vector of human galectin-3 (C-terminal lectin domain/carbohydrate recognition domain, G3CRD), tag-free protein    
RDB08394 pGEX-G3CRD-1a Bacteria expression vector of human galectin-3 (C-terminal lectin domain/carbohydrate recognition domain, G3CRD), GST fusion protein    
RDB08393 pET-G3-1a Bacteria expression vector of human galectin-3, tag-free protein    
RDB04219 pGEX-G3-1a Bacteria expression vector of human galectin-3, GST fusion protein    

(1) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.

webcatalog20240727.tab

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX046275 IRAK115L11 pCMV-SPORT6 BC053667 NM_002306 Full
HGY081536 IRAL003N24 pOTB7 BC001120 NM_002306 Full/var
HGY101917 IRAL054N05 pOTB7 BC068068 NM_002306 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2024May11.csv
GNP_full_IRAL_2024May11.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE013772 W01A034H04 pENTR-TOPO IRAL003N24 BC001120 NM_002306  
HGE013774 W01A034H06 pENTR-TOPO IRAL003N24 BC001120 NM_002306  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2024May11.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR057660 ARe44C12 pKA1U5 NM_002306.2  
GGGCGCCCGCAGCACCTCCTCGCCAGCAGCCGTCCGGAGCCAGCCAACGAGCGGAAAATG
HKR168501 ARi21E05 pGCAP10 NM_002306.2  
GGGCGCCCGCAGCACCTCCTCGCCAGCAGCCGTCCGGAGCCCGCNAACGAGCGGAAAATG
HKR247339 ARiS118F19 pGCAP10 NM_002306.2  
GGCGCCCGCAGCACCTCCTCGCCAGCAGCCGTCCGGAGCCAGCCAACGAGCGGAAAATGG
HKR276571 ARiS191H03 pGCAP10 NM_002306.2  
GGCCCGCANCACCTCCTCGCCAGCAGCCGTCCGGAGCCAGCCAACGAGCGGAAAATGGCA
HKR277904 ARiS194M16 pGCAP10 NM_002306.2  
GGCCCGCANCACCTCCTCGCCAGCAGCCGTCCGGAGCCAGCCAACGAGCGGAAAATGGCA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2024May11.csv
NRCDhumcloneList_RB_2024May11.csv

2024.09.27

Homo_sapiens_gene_info230514.csv - RDB_hum_GIxxxxxxxxx_html_240727.pl