Prev. |  KEGG KO K06528 > 

RIKEN DNA Bank Human Resource - LAMP2

Gene ID NCBI Gene 3920 |  KEGG hsa:3920
Gene Symbol LAMP2
Protein Name lysosomal associated membrane protein 2
Synonyms CD107b|DND|LAMP-2|LAMPB|LGP-96|LGP110
Featured content Lysosome (human)
Ortholog resource in our bank

  LAMP2

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY083402 IRAL008I10 pOTB7 BC002965 NM_013995 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE015148 W01A037O12 pENTR-TOPO IRAL008I10 BC002965 NM_013995  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR050852 ARe27C04 pKA1U5 NM_002294.2  
GGCTTTTGCAAGGCTGTGGTCGGTGGTCATCAGTGCTCTTGACCCAGGTCCAGCGAGCCT
HKR057751 ARe44G07 pKA1U5 NM_002294.2  
ATCCTGGGCCGCTCCGGTGACAGTCTCTGCGGAAAGTCACGTTTGTGATTTCGGGAGAGC
HKR072460 ARe81C12 pKA1U5 NM_002294.2  
GGCTTTTGCAAGGCTGTGGTCGGTGGTCATCAGTGCTCTTGACCCAGGTCCAGCGAGCCT
HKR218068 ARiS045C20 pGCAP10 NM_002294.2  
TNACAGTACGCTATNAAACTACAAATAAAACTTATAAAANTGTAACCATTTCANACCATG
HKR234377 ARiS085P17 pGCAP10 NM_002294.2  
GGCTTTTGCAAGGCTGTGGTCGGTGGTCATCAGTGCTCTTGACCCAGGTCCAGCGAGCCT
HKR279474 ARiS198L10 pGCAP10 NM_002294.2  
TGGAGGTCCAGCGAGCCTTTTCCCTGGTGTTGCAGCTGTTGTTGTACCGCCGCCGTCGCC
HKR416337 RBdS040O01 pGCAP10 NM_002294.2  
CGGCCGGCCGATGGCTTTTGCAAGGCTGTGGTCGGTGGTCATCAGTGCTCTTGACCCAGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl