RIKEN DNA Bank Human Resource - LAMB2

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number	Clone name	Vector	Constructed from(1)		CDS comparison		Status
			Clone ID	Sequence (DDBJ)	Refered mRNA	CDS status
HGE041251	W01A103C03	pENTR-TOPO	flj0021g22	AK094050	NM_002292

♦ W series clone contains a stop codon.

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number	Clone name	Vector	CDS comparison		Status
			Refered mRNA(1)	CDS status
	5'-terminal sequence(2)
HKR168811	ARi22A11	pGCAP10	NM_002292.3
	GGCTCAAAGTCGCTGGACTCTAAGCTGTCGGAGGGACCGCTGGACAGACCTGGGAACTGA
HKR209232	ARiS023B08	pGCAP10	NM_002292.3
	GGCTCAAAGTCGCTGGACTCTAAGCTGTCGGAGGGACCGCTGGACAGACCTGGGAACTGA
HKR234039	ARiS085B15	pGCAP10	NM_002292.3
	GGGACAGACCTGGGAACTGACAGAGGGCCTGGAGGGAAACAGGCCAAAGACCCACAGGCA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

2023.05.09