Prev. |  KEGG KO K06243 > 

RIKEN DNA Bank Human Resource - LAMB2

Gene ID NCBI Gene 3913 |  KEGG hsa:3913
Gene Symbol LAMB2
Protein Name laminin subunit beta 2
Synonyms LAMS|NPHS5
Ortholog resources KEGG ortholog (KEGG orthology K06243) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE041251 W01A103C03 pENTR-TOPO flj0021g22 AK094050 NM_002292 done

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR168811 ARi22A11 pGCAP10 NM_002292.3  
GGCTCAAAGTCGCTGGACTCTAAGCTGTCGGAGGGACCGCTGGACAGACCTGGGAACTGA
HKR209232 ARiS023B08 pGCAP10 NM_002292.3  
GGCTCAAAGTCGCTGGACTCTAAGCTGTCGGAGGGACCGCTGGACAGACCTGGGAACTGA
HKR234039 ARiS085B15 pGCAP10 NM_002292.3  
GGGACAGACCTGGGAACTGACAGAGGGCCTGGAGGGAAACAGGCCAAAGACCCACAGGCA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2021.03.25

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl