Prev. |  KEGG KO K17975 > 

RIKEN DNA Bank Human Resource - KTN1

Gene ID NCBI Gene 3895 |  KEGG hsa:3895
Gene Symbol KTN1
Protein Name kinectin 1
Synonyms CG1|KNT|MU-RMS-40.19
Ortholog resource in our bank

  KTN1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX043073 IRAK107L09 pCMV-SPORT6 BC050555 NM_182926 Partial/var
HGY067357 IRAK168G13 pBluescriptR BC066337 NM_182926 Partial/var
HGY100374 IRAL050P14 pOTB7 BC058736 NM_182926 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR053698 ARe34E02 pKA1U5 NM_182926.2  
TTGGGACTGCGGCGGCGGCGGCGGCGGCGGCNCCTTCNCGNGAGCGGGCGGCCCGGNCTG
HKR235413 ARiS088I21 pGCAP10 NM_182926.2  
GACCTGAGCGACTGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGCCTCGGAG
HKR247322 ARiS118F02 pGCAP10 NM_182926.2  
TGGACTGNNGCNGCTTCNGCNGCNGCGGCGGCGGCGGCGGCGGCGCCTCGGAGCGGNCGG
HKR388176 RBd70H08 pGCAP10 NM_182926.2  
GGGCGGCGGCGGCGGCGGCGCCTCGGAGCGGGCGGCCCGGGCTGTAGTGCCGGCGCCGCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl