Prev. |  KEGG KO K07604 > 

RIKEN DNA Bank Human Resource - KRT33B

Gene ID NCBI Gene 3884 |  KEGG hsa:3884
Gene Symbol KRT33B
Protein Name keratin 33B
Synonyms HA3II|Ha-3II|K33B|KRTHA3A|KRTHA3B|hHa3-II
Ortholog resources KEGG ortholog (KEGG orthology K07604) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY090767 IRAL026P07 pOTB7 BC009971 -

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE017664 W01A044C16 pENTR-TOPO IRAL026P07 BC009971 -  
HGE017668 W01A044C20 pENTR-TOPO IRAL026P07 BC009971 -  
HGE017670 W01A044C22 pENTR-TOPO IRAL026P07 BC009971 -  
HGE017672 W01A044C24 pENTR-TOPO IRAL026P07 BC009971 -  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR041612 ARe04A12 pKA1U5 NM_002279.3  
GCCCAGGGAAAAGGAATCAGGATTTTGAAACTGACTTCCAGTAGCTCCACTGCCTCCCTG
HKR041650 ARe04C02 pKA1U5 NM_002279.3  
GATTACCTGNTTCCAGCACCATGNTCTTACAGTTGTTGCCTGCCCAGCCTGGGCTGCCGC
HKR042103 ARe05E07 pKA1U5 NM_002279.3  
GCCAGGGAAAAGGAATCAGGTTTTGAAACTGACTTCCAGAGCTCCACTGCCTCCCTGCAC
HKR052979 ARe32H11 pKA1U5 NM_002279.3  
GAGGGAAAAGGAATCAGGTTTTGAAACTGACTTCCAGAGCTCCACTGCCTCCCTGCACCA
HKR070476 ARe76D04 pKA1U5 NM_002279.3  
TTGATCCCAGGGCAAAAGGAATCAGGTTTTGAAACNCNTTTNNCAGAGCTCCACTGCCTC
HKR070522 ARe76F02 pKA1U5 NM_002279.3  
GCCCAGGGAAAAGGAATCAGGTTTTGAAACTGACTTTNAGAGCTCCACTGCCTCCCTGCA
HKR076875 ARe92D03 pKA1U5 NM_002279.3  
GAGAGCTCCACTGCCTCCCTGCACCATGCCCTACAACTTCTGCCTGCCCAGCCTGAGCTG
HKR169204 ARi23A04 pGCAP10 NM_002279.3  
GATCCCAGGGAAAAGGAATCAGGTTTTGAAACTGACTTCCAGAGCTCCACTGCCTCCCTG
HKR178550 ARi46G06 pGCAP10 NM_002279.3  
GATCCCAGGGAAAAGGAATCAGGTTTTGAAACTGACTTCCAGAGCTCCACTGCCTCCCTG
HKR184880 ARi62D08 pGCAP10 NM_002279.3  
GATCCCAGGGAAAAGGAATCAGGTTTTGAAACTGACTTCCAGAGCTCCACTGCCTCCCTG
HKR184974 ARi62H06 pGCAP10 NM_002279.3  
GCCTGGGGCCTGCAACATCCCCGCCAATGTGAGCAACTGCAACTGGTTCTGTGAGGGCTC
HKR188059 ARi70C11 pGCAP10 NM_002279.3  
TGTCAGATTCTGTGTTTTAAGTTTTTTTTTTTAATTTTTTTATTTTGAGATGGAGTCTCC
HKR188435 ARi71B11 pGCAP10 NM_002279.3  
GGATTTCACCAACCACTAGCACCCAGGAAGAGCCTGGTGTGACATAAGCTGAATGGAATA
HKR203460 ARiS008K20 pGCAP10 NM_002279.3  
GAGGGAAAAGGAATCAGGTTTTGAAACTGACTTCCAGAGCTCCACTGCCTCCCTGCACCA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.18

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl