Prev. |  KEGG KO K07604 > 

RIKEN DNA Bank Human Resource - KRT10

Gene ID NCBI Gene 3858 |  KEGG hsa:3858
Gene Symbol KRT10
Protein Name keratin 10
Synonyms BCIE|BIE|CK10|EHK|K10|KPP
Ortholog resource in our bank

  KRT10

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX011544 IRAK028O08 pCMV-SPORT6 BC034697 NM_000421 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR044832 ARe12B08 pKA1U5 NM_000421.3  
GGGCGGCGGAAGCTCCGGCGGCGGCTACGGGGGCGGAAGCTCCAGCGGCGGCCACGGCGG
HKR176002 ARi40A02 pGCAP10 NM_000421.3  
GGGCTACGGAGGCGGAAGCTCCGGCGGCGGAAGCTCCGGCGGCGGCTACGGGGGCGGAAG
HKR219759 ARiS049G15 pGCAP10 NM_000421.3  
GGGCTACGGGGGCGGAAGCTCCAGCGGCGGCCACGGCGGCAGTTCCAGCGGCGGCTACGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl