Prev. |  KEGG KO K07605 > 

RIKEN DNA Bank Human Resource - KRT7

Gene ID NCBI Gene 3855 |  KEGG hsa:3855
Gene Symbol KRT7
Protein Name keratin 7
Synonyms CK7|K2C7|K7|SCL
Ortholog resources KEGG ortholog (KEGG orthology K07605) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX035475 IRAK088L11 pCMV-SPORT6 BC042076 NM_005556 Partial/var
HGY085155 IRAL012O19 pOTB7 BC002700 NM_005556 Full/var
HGY085522 IRAL013N10 pOTB7 BC009521 NM_005556 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR041745 ARe04G01 pKA1U5 NM_005556.3  
GCTCTTGCCACTGGGTCTCTCTGCTTGGGCCTCAGGGTATCTCTAGGTTCTTCACTCCCT
HKR041771 ARe04H03 pKA1U5 NM_005556.3  
GAGCGAGTGCGCGCTCCTCCTCGCCCGCCGCATAGGTCCATCCCGGCCCAGCCACCATGN
HKR043729 ARe09F09 pKA1U5 NM_005556.3  
TGAGCGAGTGCGCGCTCCTCCTCGCCCGCCGCTAGGTCCATCCCGGCCCAGCCACCATGT
HKR044951 ARe12G07 pKA1U5 NM_005556.3  
TGAGCGAGTGCGCGCTCCTCCTCGCCCGCCGCTAGGTCCATCCCGGCCCAGCCACCATGT
HKR045371 ARe13H03 pKA1U5 NM_005556.3  
GGAGTGCGCGCTCCTCCTCGCCCGCCGCTAGGTCCATCCCGGCCCAGCCACCATGTCCAT
HKR048152 ARe20G08 pKA1U5 NM_005556.3  
GGAGTGCGCGCTCCTCCTCGCCCGCCGCTAGGCCCTTNACGGCCCAGCCACCATGTCCAT
HKR048176 ARe20H08 pKA1U5 NM_005556.3  
GGAGTGCGCGCTCCTCCTCGCCCGCCGCTAGGCTCCATCCCGGCCCAGCCACCATGTCCA
HKR050851 ARe27C03 pKA1U5 NM_005556.3  
GGAGCGAGTGCGCGCTCCTCCTCGCCCGCCGCTAGGTCCATCCCGGCCCAGCCACCATGT
HKR051603 ARe29A03 pKA1U5 NM_005556.3  
GGAGTGCGCGCTTCCTCCTCGCCCGCCGCTAGGTCCATCCCGGCCCAGCCACCATGATCC
HKR058004 ARe45A04 pKA1U5 NM_005556.3  
GGAGCGAGTGCGCGCTCCTCCTCGCCCGCCGCTAGGNTCCATCCCGGCCCAGCCACCATG
HKR058083 ARe45D11 pKA1U5 NM_005556.3  
GGAGTGCGCGCTCCTCCTCGCCCGCCGCTAGGTCCATCCCGGCCCAGCCACCATGTCCAT
HKR058131 ARe45F11 pKA1U5 NM_005556.3  
GGAGTGCGCGCTCCTCCTCGCCCGCCGCTAGGTCCATCCCGGCCCAGCCACCATGTCCAT
HKR061306 ARe53E10 pKA1U5 NM_005556.3  
GGAGTTGCGCGCTCCTCCTCGCCCGCCGCTAGGTCCATCCCGGCCCAGCCACCATGATCC
HKR062851 ARe57C03 pKA1U5 NM_005556.3  
GGAGTGCGCGCTCCTCCTCGCCCGCCGCTAGGTCCATCCCGGCCCAGCCACCATGTCCAT
HKR062884 ARe57D12 pKA1U5 NM_005556.3  
GGAGTGCGCGCTCCTCCTCGCCCGCCGCTAGGTCCATCCCGGCCCAGCCACCATGTCCAT
HKR064052 ARe60C04 pKA1U5 NM_005556.3  
GGAGTGCGCGCTCCTCCTCGCCCGCCGCTAGGTCCATCCCGGCCCAGCCACCATGTCCAT
HKR064450 ARe61C02 pKA1U5 NM_005556.3  
GAGTCNAGTGCGCGCATCCTCCTCGCCCGCCGCTANCGTTTNATCCCGGCCCAGCCACCA
HKR064825 ARe62B01 pKA1U5 NM_005556.3  
GAAGCGAGCCGCCGTCCNNCNTAAGCNCGCGCGCNAGGGTCCAGTNTAATCCCCACGGNN
HKR064946 ARe62G02 pKA1U5 NM_005556.3  
AGCGAGTGCGCGCTCCTCCTCGCCCGCCGCTAGGTCCATCCCGGCCCAGCCACCATGTCC
HKR066526 ARe66F06 pKA1U5 NM_005556.3  
GGAGTGCGCGCTCCTCCTCGCCCGCCGCTAGGTCCATCCCGGCCCAGCCACCATGTCCAT
HKR067610 ARe69A10 pKA1U5 NM_005556.3  
GAGCGAGTGCGCGCTCCTCCTCGCCCGCCGCTAGGTTCCATCCCGGCCCAGCCACCATGT
HKR069258 ARe73C10 pKA1U5 NM_005556.3  
GGCGAGTGCGCGCTCCTCCTCGCCCGCCGCTANCCTTTANAANCGGCCCAGCCACCATGN
HKR069705 ARe74E09 pKA1U5 NM_005556.3  
GGAGTGCGCGCTCCTCCTCGCCCGCCGCTAGGTCCNTCCCGGCCCAGCCACCATGTCCAT
HKR071259 ARe78C11 pKA1U5 NM_005556.3  
ATCCTGAGCGAGTGCGCGCTCCTCCTCGCCCGCCGCTAGGTCCATCCCGGCCCAGCCACC
HKR073302 ARe83E06 pKA1U5 NM_005556.3  
GAGCGAGTGCGCGCTCCTCCTCGCCCGCCGCTAGGTCCATCCCGGCCCAGCCACCATGTC
HKR074008 ARe85A08 pKA1U5 NM_005556.3  
GAGCGAGTGCGCGCTCCTCCTCGCCCGCCGCTAGGTCCATCCCGGCCCAGCCACCATGTC
HKR076170 ARe90H02 pKA1U5 NM_005556.3  
GGAGTGCGCGCTCCTCCTCGCCCGCCGCTAGGTCCATCCCGGCCCAGCCACCATGTCCAT
HKR076907 ARe92E11 pKA1U5 NM_005556.3  
GGAGTGCGCGCTCCTCCTCGCCCGCCGCTAGGTCCATCCCGGCCCAGCCACCATGTCCAT
HKR077728 ARe94F08 pKA1U5 NM_005556.3  
GGAGTGCGCGCTCCTCCTCGCCCGCCGCTAGGTCCATCCCGGCCCAGCCACCATGTCCAT
HKR080433 ARf01B09 pKA1U5 NM_005556.3  
GCGAGTGCGCGCTCCTCCTCGCCCGCCGCTAGGTCCATCCCGGCCCAGCCACCATGTCCA
HKR081299 ARf03E03 pKA1U5 NM_005556.3  
ATCCTGGGAGTGCGCGCTCCTCCTCGCCCGCCGCTAGGTCCATCCCGGCCCAGCCACCAT
HKR082029 ARf05B05 pKA1U5 NM_005556.3  
GGAGTGCGCGCTCCTCCTCGCCCGCCGCTAGGTCCATCCCGGCCCAGCCACCATGNTCCA
HKR160508 ARi01E12 pGCAP10 NM_005556.3  
GAGCGAGTGCGCGCTCCTCCTCGCCCGCCGCTAGGTCCATCCCGGCCCAGCCACCATGTC
HKR160522 ARi01F02 pGCAP10 NM_005556.3  
GAGCGAGTGCGCGCTCCTCCTCGCCCGCCGCTAGGTCCATCCCGGCCCAGCCACCATGTC
HKR162505 ARi06E09 pGCAP10 NM_005556.3  
GAGCGAGTGCGCGCTCCTCCTCGCCCGCCGCTAGGTCCATCCCGGCCCAGCCACCATGTC
HKR164460 ARi11C12 pGCAP10 NM_005556.3  
GAGCGAGTGCGCGCTCCTCCTCGCCCGCCGCTAGGTCCATCCCGGCCCAGCCACCATGTC
HKR165232 ARi13B08 pGCAP10 NM_005556.3  
GGAGTGCGCGCTCCTCCTCGCCCGCCGCTAGGTCCATCCCGGCCCAGCCACCATGTCCAT
HKR165706 ARi14E10 pGCAP10 NM_005556.3  
TTTTTTTGAGCGAGTGCGCGCTCCTCCTCGCCCGCCGCTAGGTCCATCCCGGCCCAGCCA
HKR166412 ARi16A12 pGCAP10 NM_005556.3  
GAGAAAAAGGATGCAGTGAAAGAATTGAGGAGCTCAAGGAACTCAAAGGGTGCGGTTTCT
HKR166449 ARi16C01 pGCAP10 NM_005556.3  
GAGCGAGTGCGCGCTCCTCCTCGCCCGCCGCTAGGTCCATCCCGGCCCAGCCACCATGTC
HKR166480 ARi16D08 pGCAP10 NM_005556.3  
GGAGTGCGCGCTCCTCCTCGCCCGCCGCTAGGTCCATCCCGGCCCAGCCACCATGTCCAT
HKR166956 ARi17G12 pGCAP10 NM_005556.3  
GGAGTGCGCGCTCCTCCTCGCCCGCCGCTAGGTCCATCCCGGCCCAGCCACCATGTCCAT
HKR167651 ARi19C03 pGCAP10 NM_005556.3  
GGAGTGCGCGCTCCTCCTCGCCCGCCGCTAGGTCCATCCCGGCCCAGCCACCATGTCCAT
HKR167701 ARi19E05 pGCAP10 NM_005556.3  
GGAGTGCGCGCTCCTCCTCGCCCGCCGCTAGGTCCATCCCGGCCCAGCCACCATGTCCAT
HKR168401 ARi21A01 pGCAP10 NM_005556.3  
GAGCGAGTGCGCGCTCCTCCTCGCCCGCCGCTAGGTCCATCCCGGCCCAGCCACCATGTC
HKR169608 ARi24A08 pGCAP10 NM_005556.3  
GAGCGAGTGCGCGCTCCTCCTCGCCCGCCGCTAGGTCCATCCCGGCCCAGCCACCATGTC
HKR172449 ARi31C01 pGCAP10 NM_005556.3  
TGGAGTGCGCGCTCCTCCTCGCCCGCCGCTAGGTCCATCCCGGCCCAGCCACCATGTCCA
HKR174547 ARi36G03 pGCAP10 NM_005556.3  
TGGGAGCGAGTGCGCGCTCCTCCTCGCCCGCCGCTAGGTCCATCCCGGCCCAGCCACCAT
HKR174923 ARi37F03 pGCAP10 NM_005556.3  
CGGCCGGCCGATGGAGTGCGCGCTCCTCCTCGCCCGCCGCTAGGTCCATCCCGGCCCAGC
HKR175355 ARi38G11 pGCAP10 NM_005556.3  
GAGCGAGTGCGCGCTCCTCCTCGCCCGCCGCTAGGTCCATCCCGGCCCAGCCACCATGTC
HKR178055 ARi45C07 pGCAP10 NM_005556.3  
GGAGTGCGCGCTCCTCCTCGCCCGCCGCTAGGTCCATCCCGGCCCAGCCACCATGTCCAT
HKR181607 ARi54A07 pGCAP10 NM_005556.3  
GGAGTGCGCGCTCCTCCTCGCCCGCCGCTAGGTCCATCCCGGCCCAGCCACCATGTCCAT
HKR182897 ARi57E01 pGCAP10 NM_005556.3  
GGCGAGTGCGCGCTCCTCCTCGCCCGCCGCTAGGTCCATCCCGGCCCAGCCACCATGTCC
HKR184012 ARi60A12 pGCAP10 NM_005556.3  
AGCGAGTGCGCGCTCCTCCTCGCCCGCCGCTAGGTCCATCCCGGCCCAGCCACCATGTCC
HKR184552 ARi61G08 pGCAP10 NM_005556.3  
AGCGAGTGCGCGCTCCTCCTCGCCCGCCGCTAGGTCCATCCCGGCCCAGCCACCATGTCC
HKR187674 ARi69D02 pGCAP10 NM_005556.3  
AGCGAGTGCGCGCTCCTCCTCGCCCGCCGCTAGGTCCATCCCGGCCCAGCCACCATGTCC
HKR188025 ARi70B01 pGCAP10 NM_005556.3  
AGCGAGTGCGCGCTCCTCCTCGCCCGCCGCTAGGTCCATCCCGGCCCAGCCACCATGTCC
HKR205223 ARiS013A23 pGCAP10 NM_005556.3  
GAGCGNGTGNGCGCNCCTCCTCGCCCGCCGCTAGGTCCATCCCGGCCCAGCCACCATGTC
HKR205309 ARiS013E13 pGCAP10 NM_005556.3  
GAGCGAGTGCGCGCTCCTCCTCGCCCGCCGCTAGGTCCATCCCGGCCCAGCCACCATGTC
HKR208212 ARiS020I20 pGCAP10 NM_005556.3  
GGAGTGCGCGCTCCTCCTCGCCCGCCGCTAGGTCCATCCCGGCCCAGCCACCATGTCCAT
HKR208297 ARiS020M09 pGCAP10 NM_005556.3  
GAGCGAGTGCGCGCTCCTCCTCGCCCGCCGCTAGGTCCATCCCGGCCCAGCCACCATGTC
HKR209203 ARiS023A03 pGCAP10 NM_005556.3  
GAGTGCGCGCTCCTCCTCGCCCGCCGCTAGGTCCATCCCGGCCCAGCCACCATGTCCATC
HKR209289 ARiS023D17 pGCAP10 NM_005556.3  
GAGCGAGTGCGCGCTCCTCCTCGCCCGCCGCTAGGTCCATCCCGGCCCAGCCACCATGTC
HKR218350 ARiS045O14 pGCAP10 NM_005556.3  
GGAGTGCGCGCTCCTCCTCGCCCGCCGCTAGGTCCATCCCGGCCCAGCCACCATGTCCAT
HKR222086 ARiS055D14 pGCAP10 NM_005556.3  
GAGCGAGTGCGCGCTCCTCCTCGCCCGCCGCTAGGTCCATCCCGGCCCAGCCACCATGTC
HKR234240 ARiS085J24 pGCAP10 NM_005556.3  
GGAGTGCGCGCTCCTCCTCGCCCGCCGCTAGGTCCATCCCGGCCCAGCCACCATGTCCAT
HKR234802 ARiS087A02 pGCAP10 NM_005556.3  
GTTTTTCTATGGgAAATGAAgTAgGAAGGAACgCAgCCAGGGAAACTAGCTGGGCCAGGA
HKR234952 ARiS087G08 pGCAP10 NM_005556.3  
GAGCGAGTGCGCGCTCCTCCTCGCCCGCCGCTAGGTCCATCCCGGCCCAGCCACCATGTC
HKR235331 ARiS088F11 pGCAP10 NM_005556.3  
GGAGTGCGCGCTCCTCCTCGCCCGCCGCTAGGTCCATCCCGGCCCAGCCACCATGTCCAT
HKR238414 ARiS096A14 pGCAP10 NM_005556.3  
GAGCGAGTGCGCGCTCCTCCTCGCCCGCCGCTAGGTCCATCCCGGCCCAGCCACCATGTC
HKR238516 ARiS096E20 pGCAP10 NM_005556.3  
GGAGTGCGCGCTCCTCCTCGCCCGCCGCTAGGTCCATCCCGGCCCAGCCACCATGTCCAT
HKR238731 ARiS096N19 pGCAP10 NM_005556.3  
GGAGTGCGCGCTCCTCCTCGCCCGCCGCTAGGTCCATCCCGGCCCAGCCACCATGTCCAT
HKR243631 ARiS109B07 pGCAP10 NM_005556.3  
GGAGTGCGCGCTCCTCCTCTCCCGCCGNANGGGCCATCCCGGCCCAGCCACCATGTNNAT
HKR248994 ARiS122I02 pGCAP10 NM_005556.3  
GAGTGCGCGCTCCTCCTCGCCCGCCGCTAGGTCCATCCCGGCCCAGCCACCATGTCCATC
HKR260207 ARiS150I15 pGCAP10 NM_005556.3  
GGAGTGNNNGCTCCTCCTCGCCCGCCGCTAGGTCCATCCCGGCCCAGCCACCATGTCCAT
HKR260305 ARiS150M17 pGCAP10 NM_005556.3  
CGGCCGGCCGATGAGCGAGTGCGCGCTCCTCCTCGCCCGCCGCTAGGTCCATCCCGGCCC
HKR260313 ARiS150N01 pGCAP10 NM_005556.3  
GAGCGAGTGCGCGCTCCTCCTCGCCCGCCGCTAGGTCCATCCCGGCCCAGCCACCATGTC
HKR264413 ARiS161A13 pGCAP10 NM_005556.3  
GGAGTGCNCNCTCCTCCTCGCCCGCCGCTAGGTCCATCCCGGCCCAGCCACCATGTCCAT
HKR264460 ARiS161C12 pGCAP10 NM_005556.3  
GAGCGAGTGCGCGCTCCTCCTCGCCCGCCGCTAGGTCCATCCCGGCCCAGCCACCATGTC
HKR264507 ARiS161E11 pGCAP10 NM_005556.3  
GAGCGAGTGCGCGCTCCTCCTCGCCCGCCGCTAGGTCCATCCCGGCCCAGCCACCATGTC
HKR264619 ARiS161J03 pGCAP10 NM_005556.3  
GAGCGAGTGCGCGCTCCTCCTCGCCCGCCGCTAGGTCCATCCCGGCCCAGCCACCATGTC
HKR276505 ARiS191E09 pGCAP10 NM_005556.3  
GGAGTGCGCGCTCCTCCTCGCCCGCCGCTAGGTCCATCCCGGCCCAGCCACCATGTCCAT
HKR277604 ARiS194A04 pGCAP10 NM_005556.3  
GGAGTGCGCGCTCCTCCTCGCCCGCCGCTAGGTCCATCCCGGCCCAGCCACCATGTCCAT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.18

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl