Prev. | 

RIKEN DNA Bank Human Resource - KPNA4

Gene ID NCBI Gene 3840 |  KEGG hsa:3840
Gene Symbol KPNA4
Protein Name karyopherin subunit alpha 4
Synonyms IPOA3|QIP1|SRP3
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY013235 IRAK033B11 pBluescriptR BC034493 NM_002268
HGY013950 IRAK034O14 pBluescriptR BC028691 NM_002268 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR074809 ARe87A09 pKA1U5 NM_002268.3  
GGATCGAGGCTGCCTCCCCCTCTCAGCCGGCAGCACATTCCGTCGCCTTGCCGCCGCCCG
HKR420475 RBdS051D03 pGCAP10 NM_002268.3  
GAGATCGAGGCTGCCTCCCCCTCTCAGCCGGCAGCACATTCCGTCGCCCTGCCGCCGCCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.18

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl