Prev. | 

RIKEN DNA Bank Human Resource - KPNA3

Gene ID NCBI Gene 3839 |  KEGG hsa:3839
Gene Symbol KPNA3
Protein Name karyopherin subunit alpha 3
Synonyms IPOA4|SRP1|SRP1gamma|SRP4|hSRP1
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY029304 IRAK073E08 pBluescriptR BC035090 NM_002267 Full/var
HGY084617 IRAL011J01 pOTB7 BC024202 NM_002267 Full
HGY095931 IRAL039N19 pOTB7 BC017355 NM_002267 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE007845 W01A019K05 pENTR-TOPO IRAK073E08 BC035090 NM_002267  
HGE007847 W01A019K07 pENTR-TOPO IRAK073E08 BC035090 NM_002267  
HGE007857 W01A019K17 pENTR-TOPO IRAL011J01 BC024202 NM_002267  
HGE007861 W01A019K21 pENTR-TOPO IRAL011J01 BC024202 NM_002267  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR180531 ARi51F11 pGCAP10 NM_002267.3  
GGGAGCCGCGCGCAGCCATGGCCGAGAACCCCAGCTTGGAGAACCACCGCATCAAGAGCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl