Prev. |  KEGG KO K15043 > 

RIKEN DNA Bank Human Resource - KPNA2

Gene ID NCBI Gene 3838 |  KEGG hsa:3838
Gene Symbol KPNA2
Protein Name karyopherin subunit alpha 2
Synonyms IPOA1|QIP2|RCH1|SRP1-alpha|SRP1alpha
Ortholog resources KEGG ortholog (KEGG orthology K15043) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX046021 IRAK115A21 pCMV-SPORT6 BC053343 NM_002266 Full/var
HGY066922 IRAK167F02 pBluescriptR BC067848 NM_002266 Full/var
HGY088771 IRAL021P11 pDNR-LIB BC005978 NM_002266 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE025473 W01A063L09 pENTR-TOPO flj0058a05 AK024833 NM_002266 done
HGE025479 W01A063L15 pENTR-TOPO flj0058a05 AK024833 NM_002266 done
HGE007662 W01A019C14 pENTR-TOPO IRAK115A21 BC053343 NM_002266 done

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR046049 ARe15C01 pKA1U5 NM_002266.2  
GGCCACACGGTCTTTGAGCTGAGTCGAGGTGGACCCTTTGAACGCAGTCGCCCCACAGCC
HKR080459 ARf01C11 pKA1U5 NM_002266.2  
GACACGGNTCTTTGAGCTGAGTCGAGGTGGACCCTTTGAACGCAGTCGCCCCACAGCCGC
HKR173350 ARi33G06 pGCAP10 NM_002266.2  
GACACGGTCTTTGAGCTGAGTCGAGGTGGACCCTTTGAACGCAGTCGCCCTACAGCCGCT
HKR188179 ARi70H11 pGCAP10 NM_002266.2  
GACACGGTCTTTGAGCTGAGTCGAGGTGGACCCTTTGAACGCAGTCGCCCTACAGCCGCT
HKR208278 ARiS020L14 pGCAP10 NM_002266.2  
GACACNGTCTTTGAGCTGAGTCGAGGTGGACCCTTTGAACGCAGTCGCCCTACAGCCGCT
HKR320952 RBb02G08 pKA1U5 NM_002266.2  
HKR330571 RBb26H03 pGCAP1 NM_002266.2  
GAACGGTCTTTGAGCTGAGTCGAGGTGGACCCTTTGAACGCAGTCGCCCCACAGCCGCTG
HKR371747 RBd29G03 pGCAP10 NM_002266.2  
GACACACGGTCTTTGAGCTGAGTCGAGGTGGACCCTTTGAACGCAGTCGCCCCACAGCCG
HKR373751 RBd34G07 pGCAP10 NM_002266.2  
GGGCCTACTCTCTCCTCCCGTACGGCGCCGGAATCCCAGCTCCACTTACCAGGCCGCGGC
HKR384176 RBd60H08 pGCAP10 NM_002266.2  
GACACGGTCTTTGAGCTGAGTCGAGGTGGACCCTTTGAACGCAGTCGCCCCACAGCCGCT
HKR386169 RBd65H01 pGCAP10 NM_002266.2  
AAGACACGGTCTTTGAGCTGAGTCGAGGTGGACCCTTTGAACGCAGTCGCCCCACAGCCG
HKR390932 RBd77F12 pGCAP10 NM_002266.2  
GACACGGTCTTTGAGCTGAGTCGAGGTGGACCCTTTGAACGCAGTCGCCCTACAGCCGCT
HKR392101 RBd80E05 pGCAP10 NM_002266.2  
GACACGGTCTTTGAGCTGAGTCGAGGTGGACCCTTTGAACGCAGTCGCCCTACAGCCGCT
HKR399322 RBd98F02 pGCAP10 NM_002266.2  
CGGCCGGCCGATGACGGTCTTTGAGCTGAGTCGAGGTGGACCCTTTGAACGCAGTCGCCC
HKR428219 RBdS070J03 pGCAP10 NM_002266.2  
GACACGGTCTTTGAGCTGAGTCGAGGTGGACCCTTTGAACGCAGTCGCCCCACAGCCGCT
HKR430140 RBdS075F20 pGCAP10 NM_002266.2  
GGAGGTGGACCCTTTGAACGCAGTCGCCCCACAGCCGCTGATTCCCCCCGCATCGCCTCC
HKR461932 RBdS154N20 pGCAP10 NM_002266.2  
GCCTTTGAACGCAGTCGCCCCACAGCCGCTGATTCCCCCCGCATCGCCTCCCGTGGAAGC
HKR462769 RBdS156P09 pGCAP10 NM_002266.2  
GGAGTCGAGGTGGACCCTTTGAACGCAGTCGCCCCACAGCCGCTGATTCCCCCCGCATCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.18

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl