Prev. |  KEGG KO K14293 > 

RIKEN DNA Bank Human Resource - KPNB1

Gene ID NCBI Gene 3837 |  KEGG hsa:3837
Gene Symbol KPNB1
Protein Name karyopherin subunit beta 1
Synonyms IMB1|IPO1|IPOB|Impnb|NTF97
Ortholog resource in our bank

  KPNB1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB18582 KPNB1-Cherry C pcDNA Expression vector of human KPNB1/importin-beta.
RDB18583 Impβ-VC155 pcDNA Expression vector of human KPNB1/importin-beta.
RDB18584 KPNB1/Flag pcDNA Expression vector of human KPNB1/importin-beta.
RDB18585 KPNB1/pQE80L Bacterial expression vector of human KPNB1/importin-beta.

webcatalog20210331.tab


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY082061 IRAL005C13 pOTB7 BC036703 NM_002265 Full
HGY082552 IRAL006G08 pOTB7 BC024045 NM_002265 Full
HGY082563 IRAL006G19 pOTB7 BC003572 NM_002265 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2021Apr07.csv
GNP_full_IRAL_2021Apr13.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR061674 ARe54D02 pKA1U5 NM_002265.4  
GCCCTCCCTGCGCGCCGCCTCTCACTCACAGCCTCCCTTCCTTCTTTCTCCCTCCGCCTC
HKR174081 ARi35D09 pGCAP10 NM_002265.4  
GTTCCTTCTTTCTCCCTCCGCCTCCCGAGCACCAGCGCGCTCTGAGCTGCCCCCAGGGTC
HKR176807 ARi42A07 pGCAP10 NM_002265.4  
GGCCGCCAGCAGCCCATTTGGAGGGAGGAAGTAAGGGAAGAGGAGAGGAAGGGGAGCCGG
HKR337678 RBb44D06 pGCAP1 NM_002265.4  
GACTCACAGCCTCCCTTCCTTCTTTCTCCCTCCGCCTCCCGAGCACCAGCGCGCTCTGAG
HKR362123 RBd05F03 pGCAP10 NM_002265.4  
GACTCACAGCCTCCCTTCCTTCTTTCTCCCTCCGCCTCCCGAGCACCAGCGCGCTCTGAG
HKR365279 RBd13D07 pGCAP10 NM_002265.4  
TGGCTCCGCCTCCCGAGCACCAGCGCGCTCTGAGCTGCCCCCAGGGTCCCTCCCCCGCCG
HKR365331 RBd13F11 pGCAP10 NM_002265.4  
GAGCTTCCCTTCCTTCTTTCTCCCTCCGCCTCCCGAGCACCAGCGCG
HKR462586 RBdS156H18 pGCAP10 NM_002265.4  
GNNNNNNNGCCTCCCTTCCTTCTTTCTCCCTCCGCCTCCCGAGCACCAGCGCGCTCTGAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_210404.csv
NRCDhumcloneList_RB_210404.csv


2022.02.15

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_220215.pl