Prev. | Human A to Z list > K > 

RIKEN DNA Bank Human Resource - KIF22

Gene ID (NCBI) 3835
Gene Symbol KIF22
Protein Name kinesin family member 22
Synonyms A-328A3.2|KID|KNSL4|OBP|OBP-1|OBP-2|SEMDJL2
Databases KEGG link 01 |  NCBI Gene link 01
Featured content Ortholog resources in the DNA Bank (KEGG orthology K10403)


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGX025067 IRAK062L03 pCMV-SPORT6 BC028155 NM_007317 Full
HGY083321 IRAL008F01 pOTB7 BC004352 NM_007317 Full

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_170405.csv
GNP_full_IRAL_170405.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR166483 ARi16D11 pGCAP10 NM_007317.1  
GAGGGAGTGGAATGGCCGCGGGCGGCTCGACGCAGCAGAGGCGACGCGAGATGGCGGCAG
HKR060880 ARe52D08 pKA1U5 NM_007317.1  
GGGAATGGCCNCTTTTGGCTCCACANCAGCAGACCCTATNACGNAGATGGCGGCAGCTTC
HKR334179 RBb35H11 pGCAP1 NM_007317.1  
GGGGCCCAAGGAGGGAGTGGAATGGCCGCGGGCGGCTCGACGCAGCAGAGGCGACGCGAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2017.08.23

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_170416.pl