Prev. |  KEGG KO K10405 > 

RIKEN DNA Bank Human Resource - KIFC1

Gene ID NCBI Gene 3833 |  KEGG hsa:3833
Gene Symbol KIFC1
Protein Name kinesin family member C1
Synonyms HSET|KNSL2
Ortholog resources KEGG ortholog (KEGG orthology K10405) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX053624 IRAK134A24 pCMV-SPORT6 BC063567 NM_002263 Full/var
HGX066437 IRAK166B13 pCMV-SPORT6 BC073878 NM_002263 Full/var
HGY082998 IRAL007I06 pOTB7 BC000712 NM_002263

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR330010 RBb25A10 pGCAP1 NM_002263.3  
GACCCTGCTTCGCGAGCGGGCGAGAGAACGCGAGTCCCAGGATCCCCGGCACCCAGTTCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.18

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl