Prev. |  KEGG KO K06509 > 

RIKEN DNA Bank Human Resource - CD82

Gene ID NCBI Gene 3732 |  KEGG hsa:3732
Gene Symbol CD82
Protein Name CD82 molecule
Synonyms 4F9|C33|GR15|IA4|KAI1|R2|SAR2|ST6|TSPAN27
Ortholog resource in our bank

  CD82

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Individualy Deposited Resource

Catalog number Name of Resource Description
RDB01891 pRx-hCD82 Shuttle vector to generate recombinant retrovirus vector expressing human CD82
RDB07416 pGL4-phCD82 Promoter collection, Human CD82 promoter
RDB07605 pcDNA3.1D/V5-His-TOPO-hCD82 Expression vector of human CD82.

webcatalog20220516.tab

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY081104 IRAL002M16 pOTB7 BC000726 NM_002231 Full/var
HGY084199 IRAL010I07 pOTB7 BC001821 NM_002231 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Jun29.csv
GNP_full_IRAL_2023Jun29.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE014301 W01A035M13 pENTR-TOPO IRAL002M16 BC001821 NM_002231  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR048826 ARe22B02 pKA1U5 NM_002231.3  
GGGCTGCAGCCGGGAGGGGGCCGAGGAGTGACTGAGCCCCGGGCTGTGCAGTCCGACGCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.08.17

Homo_sapiens_gene_info230514.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl