Prev. |  KEGG KO K00913 > 

RIKEN DNA Bank Human Resource - ITPK1

Gene ID NCBI Gene 3705 |  KEGG hsa:3705
Gene Symbol ITPK1
Protein Name inositol-tetrakisphosphate 1-kinase
Synonyms ITRPK1
Featured content Kinases Included in Myristoylated Kinase Library (human) in Boehm JS Cell 129 (6):1065-1079 (2007). PMID: 17574021.
Ortholog resource in our bank

  ITPK1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY018950 IRAK047G06 pBluescriptR BC037305 NM_014216 Full/var
HGY081466 IRAL003L02 pOTB7 BC003622 NM_014216 Partial
HGY084258 IRAL010K18 pOTB7 BC007428 NM_014216 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE010273 W01A025L09 pENTR-TOPO IRAL010K18 BC003622 NM_014216  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR058545 ARe46G01 pKA1U5 NM_014216.4  
GCCCGCTCCGCTCCGCGCGGCAGGACTGCGCGCCCCAGCTCCGATCCCCGTTCCGCGTCC
HKR406246 RBdS015K06 pGCAP10 NM_014216.4  
GAGCTCCGATCCCCGTTCCGCGTCCCCGCCGCCGGGAGGAGGTGCCCACTCGCTCGCGGC
HKR461679 RBdS154D07 pGCAP10 NM_014216.4  
GGCCGCGGGCTCAAGCGGGGCGNCCGGGCCAGCGCGGGGCGGCGGCGGGNANGGGCGGCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl