Prev. |  KEGG KO K07151 > 

RIKEN DNA Bank Human Resource - STT3A

Gene ID NCBI Gene 3703 |  KEGG hsa:3703
Gene Symbol STT3A
Protein Name STT3 oligosaccharyltransferase complex catalytic subunit A
Synonyms ITM1|STT3-A|TMC
Ortholog resource in our bank

  STT3A

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX005718 IRAK014E22 pCMV-SPORT6 BC020965 NM_152713

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE092004 M01C030A04 pDONR221 MGC04-F02 BC020965 NM_152713  
HGE092052 M01C030C04 pDONR221 MGC04-F02 BC020965 NM_152713  
HGE092100 M01C030E04 pDONR221 MGC04-F02 BC020965 NM_152713  
HGE092148 M01C030G04 pDONR221 MGC04-F02 BC020965 NM_152713  
HGE092196 M01C030I04 pDONR221 MGC04-F02 BC020965 NM_152713  
HGE092244 M01C030K04 pDONR221 MGC04-F02 BC020965 NM_152713  
HGE092292 M01C030M04 pDONR221 MGC04-F02 BC020965 NM_152713  
HGE092340 M01C030O04 pDONR221 MGC04-F02 BC020965 NM_152713  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR205247 ARiS013B23 pGCAP10 NM_152713.3  
GGGCTGAGGGAGCCCCGCGGATCGTTTAGGAAAGCCGGCCAGCTGATCGTCGTGTGTTGC
HKR219732 ARiS049F12 pGCAP10 NM_152713.3  
GGAGGGAGCCCCGCGGATCGTTTAGGAAAGCCGGCCAGCTGATCGTCGTGTGTTGCCACC
HKR405503 RBdS013M15 pGCAP10 NM_152713.3  
GCGGCTCCTGCCAGGGTTGGGTGCGCCGCTGAACGGATGGCTGAGGGAGCCCCGCGGATC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl