Prev. |  KEGG KO K06588 > 

RIKEN DNA Bank Human Resource - ITGB5

Gene ID NCBI Gene 3693 |  KEGG hsa:3693
Gene Symbol ITGB5
Protein Name integrin subunit beta 5
Synonyms -
Ortholog resource in our bank

  ITGB5

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Individualy Deposited Resource

Catalog number Name of Resource Description
RDB07665 pcDNA3.1(+)-h Integrin beta5

webcatalog20220516.tab

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY081094 IRAL002M06 pOTB7 BC006541 NM_002213

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Jun29.csv
GNP_full_IRAL_2023Jun29.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR079756 ARe99G12 pKA1U5 NM_002213.3  
GGGGCAGAGTGTGCCGGCGCGCGGGGGAGTCTCGGCGCTGGGCGCGTCTCGGAGCCCAAG
HKR168146 ARi20G02 pGCAP10 NM_002213.3  
GCCCCGGCCGGCCAGCCAGGGCAGCCGCGGTCCCGGGACTCGNCCGTGAGTGCTGCGGGA
HKR177308 ARi43E12 pGCAP10 NM_002213.3  
GGGCCAGCCAGGGCAGCCGCGGTCCCGGGACTCGGCCGTGAGTGCTGCGGGACGGATGGT
HKR276468 ARiS191C20 pGCAP10 NM_002213.3  
GAGAGTGTGCCGNCNCNCNNNNGANTCTCNGNGCTGGNCGCGTCTCGGAGCCCAAGTCGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.08.17

Homo_sapiens_gene_info230514.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl