Prev. |  KEGG KO K06525 > 

RIKEN DNA Bank Human Resource - ITGB4

Gene ID NCBI Gene 3691 |  KEGG hsa:3691
Gene Symbol ITGB4
Protein Name integrin subunit beta 4
Synonyms CD104|GP150
Ortholog resource in our bank

  ITGB4

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB05530 pKM2L-phIGNB4 Promoter Bank clone, Human integrin-beta 4 promoter
RDB07664 pcDNA3.1(+)-h Integrin beta4

webcatalog20220516.tab


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR205215 ARiS013A15 pGCAP10 NM_000213.3 done
GAACCCCCNCGCCCGCCCTCGGACAGTCCCTGCTCGCCCGCGCGCTGCAGCCCCATCTCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2022Apr03.csv
NRCDhumcloneList_RB_2022Apr03.csv


2022.05.19

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_220215.pl