RIKEN DNA Bank Human Resource

RIKEN DNA Bank Human Resource - ITGB4

Gene ID	NCBI Gene 3691 \| KEGG hsa:3691
Gene Symbol	ITGB4
Protein Name	integrin subunit beta 4
Synonyms	CD104\|GP150

Ortholog resource in our bank

  ITGB4

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Individualy Deposited Resource

Catalog number	Name of Resource	Description
RDB05530	pKM2L-phIGNB4	Promoter Bank clone, Human integrin-beta 4 promoter
RDB07664	pcDNA3.1(+)-h Integrin beta4

webcatalog20220516.tab

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number	Clone name	Vector	CDS comparison
	Clone name	Vector	Refered mRNA⁽¹⁾	CDS status
	5'-terminal sequence⁽²⁾
HKR205215	ARiS013A15	pGCAP10	NM_000213.3	VA
HKR205215	GAACCCCCNCGCCCGCCCTCGGACAGTCCCTGCTCGCCCGCGCGCTGCAGCCCCATCTCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl