Prev. | Human A to Z list > I > 

RIKEN DNA Bank Human Resource - ITGB1

Gene ID (NCBI) 3688
Gene Symbol ITGB1
Protein Name integrin subunit beta 1
Synonyms CD29|FNRB|GPIIA|MDF2|MSK12|VLA-BETA|VLAB
Databases KEGG hsa:3688 |  NCBI Gene 3688
Featured content Axon guidance - human
Featured content Ortholog resources in the DNA Bank (KEGG orthology K05719)


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGX010513 IRAK026E17 pCMV-SPORT6 BC020057 NM_133376 Full

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_170405.csv
GNP_full_IRAL_170405.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE010537 W01A026F17 pENTR-TOPO IRAK026E17 BC020057 NM_133376  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com/site/us/en/home.html


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR042956 ARe07G12 pKA1U5 NM_002211.3  
GGCCAGCCCGCGGGAGAGGCCCAGCGGGAGTCGCGNTAACAGCAGGCCCGAGCCCACCGC
HKR080851 ARf02C03 pKA1U5 NM_002211.3  
GCAGCCCGCGGGAGAGGCCCAGCGGGAGTCGCGGAACAGCAGGCCCGAGCCCACCGCGCC
HKR081253 ARf03C05 pKA1U5 NM_002211.3  
GAGCGGGAGTCGCGGAACAGCAGGCCCGAGCCCACCGCGCCGGGCCCCGGACGCCGCGCG
HKR082055 ARf05C07 pKA1U5 NM_002211.3  
GGGGAGAGGCCCAGCGGGAGTCGCGGAACAGCAGGCCCGAGCCCACCGCGCCGGGCCCCG
HKR082882 ARf07D10 pKA1U5 NM_002211.3  
GGCCAGCCCGCGGGAGAGGCCCAGCGGGAGTCGCGGAACAGCAGGCCCGAGCCCACCGCG
HKR163207 ARi08A07 pGCAP10 NM_002211.3  
GAGCCCGCGGGAGAGGCCCAGCGGGAGTCGCGGAACAGCAGGCCCGAGCCCACCGCGCCG
HKR044106 ARe10E10 pKA1U5 NM_002211.3  
GGCCGCCACCCGCCGCGCCCGACACCCGGGAGGCCCCGCCAGCCCGCGGGAGAGGCCCAG
HKR046860 ARe17C12 pKA1U5 NM_002211.3  
GGCCAGCCCGCGGGAGAGGCCCAGCGGGAGTCGCGGAACAGCAGGCCCGAGCCCACCGCG
HKR166108 ARi15E12 pGCAP10 NM_002211.3  
GGGAGGAGCCGCCGCCACCCGCCGCGCCCGACACCCGGGAGGCCCCGCCAGCCCGCGGGA
HKR171770 ARi29H02 pGCAP10 NM_002211.3  
GGCCAGCCCGCGGGAGAGGCCCAGCGGGAGTCGCGGAACAGCAGGCCCGAGCCCACCGCG
HKR174007 ARi35A07 pGCAP10 NM_002211.3  
GAGAGGCCCAGCGGGAGTCGCGGAACAGCAGGCCCGAGCCCACCGCGCCGGGCCCCGGAC
HKR174931 ARi37F11 pGCAP10 NM_002211.3  
GGCCCCTGAGGAGGAGGAGCCGCCGCCACCCGCCGCGCCCGACACCCGGGAGGCCCCGCC
HKR179674 ARi49D02 pGCAP10 NM_002211.3  
GAGCCCGCGGGAGAGGCCCAGCGGGAGTCGCGGAACAGCAGGCCCGAGCCCACCGCGCCG
HKR062478 ARe56D06 pKA1U5 NM_002211.3  
ATCCTGGGCCCCGGACGCCGCGCGGAAAAGATGNCNTTTACAACCAATTTTCTGGATTGG
HKR063323 ARe58F03 pKA1U5 NM_002211.3  
ATCCTGGAGCCCGCGGGAGAGGCCCAGCGGGAGTCGCGGAACAGCAGGCCCGAGCCCACC
HKR065772 ARe64H04 pKA1U5 NM_002211.3  
GGGGAGAGGCCCAGCGGGAGTCGCGGAACAGCANGCCCGAGCCCACCGCGCCGGGCCCCG
HKR072433 ARe81B09 pKA1U5 NM_002211.3  
TGGGGGAGAGGCCCAGCGGGAGTCGCGGAACAGCAGGCCCGAGCCCACCGCGCCGGGCCC
HKR076104 ARe90E08 pKA1U5 NM_002211.3  
GGGGAGAGGCCCAGCGGGAGTCGCGGAACAGCAGGCCCGAGCCCACCGCGCCGGGCCCCG
HKR077352 ARe93G08 pKA1U5 NM_002211.3  
GAGCCCGCGGGAGAGGCCCAGCGGGAGTCGCGGAACAGCAGGCCCGAGCCCACCGCGCCG
HKR203514 ARiS008N02 pGCAP10 NM_002211.3  
GGCCAGCCCGCGGGAGAGGCCCAGCGGGAGTCGCGGAACAGCAGGCCCGAGCCCACCGCG
HKR205274 ARiS013D02 pGCAP10 NM_002211.3  
GACCCGCCGCGCCCGACACCCGGGAGGCCCCGCCAGCCCGCGGGAGAGGCCCAGCGGGAG
HKR219901 ARiS049M13 pGCAP10 NM_002211.3  
GGCCNGCCCGCGGGAGAGGCCCAGCGGGAGTCGCGGAACAGCAGGCCCGAGCCCACCGCG
HKR235202 ARiS088A02 pGCAP10 NM_002211.3  
GACCCGGGAGGCCCCGCCAGCCCGCGGGAGAGGCCCAGCGGGAGTCGCGGAACAGCAGGC
HKR235444 ARiS088K04 pGCAP10 NM_002211.3  
GACCCGGGAGGCCCCGCCAGCCCGCGGGAGAGGCCCAGCGGGAGTCGCGGAACAGCAGGC
HKR235577 ARiS088P17 pGCAP10 NM_002211.3  
GGGGAGAGGCCCAGCGGGAGTCGCGGAACAGCAGGCCCGAGCCCACCGCGCCGGGCCCCG
HKR279538 ARiS198O02 pGCAP10 NM_002211.3  
GAGCCCGCGGGAGAGGCCCAGCGGGAGTCGCGGAACAGCAGGCCCGAGCCCACCGCGCCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2018.02.22

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_180123.pl