Prev. | Human A to Z list > I > 

RIKEN DNA Bank Human Resource - IRF7

Gene ID (NCBI) 3665
Gene Symbol IRF7
Protein Name interferon regulatory factor 7
Synonyms IMD39|IRF-7H|IRF7A|IRF7B|IRF7C|IRF7H
Databases KEGG hsa:3665 |  NCBI Gene 3665
Featured content Toll-like receptor signaling pathway - human
Featured content Ortholog resources in the DNA Bank (KEGG orthology K09447)


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR046806 ARe17A06 pKA1U5 NM_001572.3 done
GGAGACGAAACTTCCCGTCCCGGCGGCTCTGGCACCCAGGGNTCCGGCCTGCGCCTTCCC
HKR058428 ARe46B04 pKA1U5 NM_001572.3  
GGAGACGAAACTTCCCGTCCCGGCGGCTCTGGCACCCAGGGNTCCGGCCTGCGCCTTCCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2018.06.19

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_180123.pl