Prev. |  KEGG KO K09446 > 

RIKEN DNA Bank Human Resource - IRF5

Gene ID NCBI Gene 3663 |  KEGG hsa:3663
Gene Symbol IRF5
Protein Name interferon regulatory factor 5
Synonyms SLEB10
Ortholog resources KEGG ortholog (KEGG orthology K09446) in the DNA Bank
Featured content Toll-like receptor signaling pathway - human
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY084233 IRAL010J17 pOTB7 BC004201 NM_032643 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR168922 ARi22F02 pGCAP10 NM_002200.3 done
GGGGAGGCGCAGCCTGGGCAGAGCTCAGCTTGGTCCCGCCGCCCGGCCGGTGCTCCCTGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.18

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl